ID: 1135482844

View in Genome Browser
Species Human (GRCh38)
Location 16:22836827-22836849
Sequence ATTTATTTACTAGTAGAGAC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135482841_1135482844 7 Left 1135482841 16:22836797-22836819 CCACGCCTGGCTAAATTTTTTTT 0: 65
1: 2420
2: 15878
3: 67117
4: 168310
Right 1135482844 16:22836827-22836849 ATTTATTTACTAGTAGAGACGGG No data
1135482842_1135482844 2 Left 1135482842 16:22836802-22836824 CCTGGCTAAATTTTTTTTGTTAT No data
Right 1135482844 16:22836827-22836849 ATTTATTTACTAGTAGAGACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135482844 Original CRISPR ATTTATTTACTAGTAGAGAC GGG Intronic
No off target data available for this crispr