ID: 1135486796

View in Genome Browser
Species Human (GRCh38)
Location 16:22872698-22872720
Sequence ATGGACTGCCTCATTGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135486787_1135486796 23 Left 1135486787 16:22872652-22872674 CCACGTAAGTACCTCAACCAGCA No data
Right 1135486796 16:22872698-22872720 ATGGACTGCCTCATTGAGGATGG No data
1135486788_1135486796 12 Left 1135486788 16:22872663-22872685 CCTCAACCAGCAACTCTGACGTG No data
Right 1135486796 16:22872698-22872720 ATGGACTGCCTCATTGAGGATGG No data
1135486785_1135486796 29 Left 1135486785 16:22872646-22872668 CCTGGCCCACGTAAGTACCTCAA No data
Right 1135486796 16:22872698-22872720 ATGGACTGCCTCATTGAGGATGG No data
1135486790_1135486796 6 Left 1135486790 16:22872669-22872691 CCAGCAACTCTGACGTGGACCGC No data
Right 1135486796 16:22872698-22872720 ATGGACTGCCTCATTGAGGATGG No data
1135486786_1135486796 24 Left 1135486786 16:22872651-22872673 CCCACGTAAGTACCTCAACCAGC No data
Right 1135486796 16:22872698-22872720 ATGGACTGCCTCATTGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135486796 Original CRISPR ATGGACTGCCTCATTGAGGA TGG Intronic
No off target data available for this crispr