ID: 1135487136

View in Genome Browser
Species Human (GRCh38)
Location 16:22875665-22875687
Sequence ACACTTAGGCCACACTGCGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135487136_1135487139 10 Left 1135487136 16:22875665-22875687 CCACCGCAGTGTGGCCTAAGTGT No data
Right 1135487139 16:22875698-22875720 TAAAACCTGCAGTTGTGTACAGG No data
1135487136_1135487141 21 Left 1135487136 16:22875665-22875687 CCACCGCAGTGTGGCCTAAGTGT No data
Right 1135487141 16:22875709-22875731 GTTGTGTACAGGAATGTCCTAGG 0: 2
1: 17
2: 200
3: 463
4: 687

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135487136 Original CRISPR ACACTTAGGCCACACTGCGG TGG (reversed) Intronic
No off target data available for this crispr