ID: 1135493264

View in Genome Browser
Species Human (GRCh38)
Location 16:22928873-22928895
Sequence CTGTCCTAACGTCTTGGGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135493264_1135493272 7 Left 1135493264 16:22928873-22928895 CCATTCCCAAGACGTTAGGACAG No data
Right 1135493272 16:22928903-22928925 ATCTGGTGTTTGGTCAGGAAGGG No data
1135493264_1135493267 -10 Left 1135493264 16:22928873-22928895 CCATTCCCAAGACGTTAGGACAG No data
Right 1135493267 16:22928886-22928908 GTTAGGACAGTTGACCTATCTGG No data
1135493264_1135493268 -3 Left 1135493264 16:22928873-22928895 CCATTCCCAAGACGTTAGGACAG No data
Right 1135493268 16:22928893-22928915 CAGTTGACCTATCTGGTGTTTGG No data
1135493264_1135493273 8 Left 1135493264 16:22928873-22928895 CCATTCCCAAGACGTTAGGACAG No data
Right 1135493273 16:22928904-22928926 TCTGGTGTTTGGTCAGGAAGGGG No data
1135493264_1135493271 6 Left 1135493264 16:22928873-22928895 CCATTCCCAAGACGTTAGGACAG No data
Right 1135493271 16:22928902-22928924 TATCTGGTGTTTGGTCAGGAAGG No data
1135493264_1135493274 11 Left 1135493264 16:22928873-22928895 CCATTCCCAAGACGTTAGGACAG No data
Right 1135493274 16:22928907-22928929 GGTGTTTGGTCAGGAAGGGGTGG No data
1135493264_1135493269 2 Left 1135493264 16:22928873-22928895 CCATTCCCAAGACGTTAGGACAG No data
Right 1135493269 16:22928898-22928920 GACCTATCTGGTGTTTGGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135493264 Original CRISPR CTGTCCTAACGTCTTGGGAA TGG (reversed) Intergenic
No off target data available for this crispr