ID: 1135494826

View in Genome Browser
Species Human (GRCh38)
Location 16:22942288-22942310
Sequence CTCCAGGAGTTGCTTCCCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135494826_1135494830 -2 Left 1135494826 16:22942288-22942310 CCCAGGGGAAGCAACTCCTGGAG No data
Right 1135494830 16:22942309-22942331 AGAACTCCTCAAGGATACCCTGG No data
1135494826_1135494835 20 Left 1135494826 16:22942288-22942310 CCCAGGGGAAGCAACTCCTGGAG No data
Right 1135494835 16:22942331-22942353 GAAAGCAAGTATAAGAGGCCTGG No data
1135494826_1135494833 15 Left 1135494826 16:22942288-22942310 CCCAGGGGAAGCAACTCCTGGAG No data
Right 1135494833 16:22942326-22942348 CCCTGGAAAGCAAGTATAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135494826 Original CRISPR CTCCAGGAGTTGCTTCCCCT GGG (reversed) Intergenic