ID: 1135494827

View in Genome Browser
Species Human (GRCh38)
Location 16:22942289-22942311
Sequence TCTCCAGGAGTTGCTTCCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135494827_1135494830 -3 Left 1135494827 16:22942289-22942311 CCAGGGGAAGCAACTCCTGGAGA No data
Right 1135494830 16:22942309-22942331 AGAACTCCTCAAGGATACCCTGG No data
1135494827_1135494835 19 Left 1135494827 16:22942289-22942311 CCAGGGGAAGCAACTCCTGGAGA No data
Right 1135494835 16:22942331-22942353 GAAAGCAAGTATAAGAGGCCTGG No data
1135494827_1135494833 14 Left 1135494827 16:22942289-22942311 CCAGGGGAAGCAACTCCTGGAGA No data
Right 1135494833 16:22942326-22942348 CCCTGGAAAGCAAGTATAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135494827 Original CRISPR TCTCCAGGAGTTGCTTCCCC TGG (reversed) Intergenic
No off target data available for this crispr