ID: 1135494829

View in Genome Browser
Species Human (GRCh38)
Location 16:22942304-22942326
Sequence GTATCCTTGAGGAGTTCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135494829_1135494835 4 Left 1135494829 16:22942304-22942326 CCTGGAGAACTCCTCAAGGATAC No data
Right 1135494835 16:22942331-22942353 GAAAGCAAGTATAAGAGGCCTGG No data
1135494829_1135494833 -1 Left 1135494829 16:22942304-22942326 CCTGGAGAACTCCTCAAGGATAC No data
Right 1135494833 16:22942326-22942348 CCCTGGAAAGCAAGTATAAGAGG No data
1135494829_1135494837 24 Left 1135494829 16:22942304-22942326 CCTGGAGAACTCCTCAAGGATAC No data
Right 1135494837 16:22942351-22942373 TGGCCACTCCCTTAGTCAACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135494829 Original CRISPR GTATCCTTGAGGAGTTCTCC AGG (reversed) Intergenic
No off target data available for this crispr