ID: 1135494830

View in Genome Browser
Species Human (GRCh38)
Location 16:22942309-22942331
Sequence AGAACTCCTCAAGGATACCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135494826_1135494830 -2 Left 1135494826 16:22942288-22942310 CCCAGGGGAAGCAACTCCTGGAG No data
Right 1135494830 16:22942309-22942331 AGAACTCCTCAAGGATACCCTGG No data
1135494821_1135494830 18 Left 1135494821 16:22942268-22942290 CCTTAACTATGAATACAGAGCCC No data
Right 1135494830 16:22942309-22942331 AGAACTCCTCAAGGATACCCTGG No data
1135494827_1135494830 -3 Left 1135494827 16:22942289-22942311 CCAGGGGAAGCAACTCCTGGAGA No data
Right 1135494830 16:22942309-22942331 AGAACTCCTCAAGGATACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135494830 Original CRISPR AGAACTCCTCAAGGATACCC TGG Intergenic
No off target data available for this crispr