ID: 1135494835

View in Genome Browser
Species Human (GRCh38)
Location 16:22942331-22942353
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135494826_1135494835 20 Left 1135494826 16:22942288-22942310 CCCAGGGGAAGCAACTCCTGGAG No data
Right 1135494835 16:22942331-22942353 GAAAGCAAGTATAAGAGGCCTGG No data
1135494827_1135494835 19 Left 1135494827 16:22942289-22942311 CCAGGGGAAGCAACTCCTGGAGA No data
Right 1135494835 16:22942331-22942353 GAAAGCAAGTATAAGAGGCCTGG No data
1135494829_1135494835 4 Left 1135494829 16:22942304-22942326 CCTGGAGAACTCCTCAAGGATAC No data
Right 1135494835 16:22942331-22942353 GAAAGCAAGTATAAGAGGCCTGG No data
1135494831_1135494835 -7 Left 1135494831 16:22942315-22942337 CCTCAAGGATACCCTGGAAAGCA No data
Right 1135494835 16:22942331-22942353 GAAAGCAAGTATAAGAGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135494835 Original CRISPR GAAAGCAAGTATAAGAGGCC TGG Intergenic