ID: 1135498649

View in Genome Browser
Species Human (GRCh38)
Location 16:22974800-22974822
Sequence ACTGGACTTTCTGGTTCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135498649_1135498655 -10 Left 1135498649 16:22974800-22974822 CCTTCTGAACCAGAAAGTCCAGT No data
Right 1135498655 16:22974813-22974835 AAAGTCCAGTGGGGAGCTCTGGG No data
1135498649_1135498658 16 Left 1135498649 16:22974800-22974822 CCTTCTGAACCAGAAAGTCCAGT No data
Right 1135498658 16:22974839-22974861 TGAGAGACTGAATATACAGGTGG No data
1135498649_1135498659 23 Left 1135498649 16:22974800-22974822 CCTTCTGAACCAGAAAGTCCAGT No data
Right 1135498659 16:22974846-22974868 CTGAATATACAGGTGGACAAAGG No data
1135498649_1135498657 13 Left 1135498649 16:22974800-22974822 CCTTCTGAACCAGAAAGTCCAGT No data
Right 1135498657 16:22974836-22974858 AATTGAGAGACTGAATATACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135498649 Original CRISPR ACTGGACTTTCTGGTTCAGA AGG (reversed) Intergenic
No off target data available for this crispr