ID: 1135498653 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 16:22974809-22974831 |
Sequence | GAGCTCCCCACTGGACTTTC TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1135498653_1135498659 | 14 | Left | 1135498653 | 16:22974809-22974831 | CCAGAAAGTCCAGTGGGGAGCTC | No data | ||
Right | 1135498659 | 16:22974846-22974868 | CTGAATATACAGGTGGACAAAGG | No data | ||||
1135498653_1135498657 | 4 | Left | 1135498653 | 16:22974809-22974831 | CCAGAAAGTCCAGTGGGGAGCTC | No data | ||
Right | 1135498657 | 16:22974836-22974858 | AATTGAGAGACTGAATATACAGG | No data | ||||
1135498653_1135498658 | 7 | Left | 1135498653 | 16:22974809-22974831 | CCAGAAAGTCCAGTGGGGAGCTC | No data | ||
Right | 1135498658 | 16:22974839-22974861 | TGAGAGACTGAATATACAGGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1135498653 | Original CRISPR | GAGCTCCCCACTGGACTTTC TGG (reversed) | Intergenic | ||
No off target data available for this crispr |