ID: 1135498653

View in Genome Browser
Species Human (GRCh38)
Location 16:22974809-22974831
Sequence GAGCTCCCCACTGGACTTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135498653_1135498659 14 Left 1135498653 16:22974809-22974831 CCAGAAAGTCCAGTGGGGAGCTC No data
Right 1135498659 16:22974846-22974868 CTGAATATACAGGTGGACAAAGG No data
1135498653_1135498657 4 Left 1135498653 16:22974809-22974831 CCAGAAAGTCCAGTGGGGAGCTC No data
Right 1135498657 16:22974836-22974858 AATTGAGAGACTGAATATACAGG No data
1135498653_1135498658 7 Left 1135498653 16:22974809-22974831 CCAGAAAGTCCAGTGGGGAGCTC No data
Right 1135498658 16:22974839-22974861 TGAGAGACTGAATATACAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135498653 Original CRISPR GAGCTCCCCACTGGACTTTC TGG (reversed) Intergenic
No off target data available for this crispr