ID: 1135498656

View in Genome Browser
Species Human (GRCh38)
Location 16:22974818-22974840
Sequence CAATTCCCAGAGCTCCCCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135498656_1135498658 -2 Left 1135498656 16:22974818-22974840 CCAGTGGGGAGCTCTGGGAATTG No data
Right 1135498658 16:22974839-22974861 TGAGAGACTGAATATACAGGTGG No data
1135498656_1135498657 -5 Left 1135498656 16:22974818-22974840 CCAGTGGGGAGCTCTGGGAATTG No data
Right 1135498657 16:22974836-22974858 AATTGAGAGACTGAATATACAGG No data
1135498656_1135498659 5 Left 1135498656 16:22974818-22974840 CCAGTGGGGAGCTCTGGGAATTG No data
Right 1135498659 16:22974846-22974868 CTGAATATACAGGTGGACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135498656 Original CRISPR CAATTCCCAGAGCTCCCCAC TGG (reversed) Intergenic
No off target data available for this crispr