ID: 1135498659

View in Genome Browser
Species Human (GRCh38)
Location 16:22974846-22974868
Sequence CTGAATATACAGGTGGACAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135498648_1135498659 28 Left 1135498648 16:22974795-22974817 CCAGGCCTTCTGAACCAGAAAGT No data
Right 1135498659 16:22974846-22974868 CTGAATATACAGGTGGACAAAGG No data
1135498649_1135498659 23 Left 1135498649 16:22974800-22974822 CCTTCTGAACCAGAAAGTCCAGT No data
Right 1135498659 16:22974846-22974868 CTGAATATACAGGTGGACAAAGG No data
1135498647_1135498659 29 Left 1135498647 16:22974794-22974816 CCCAGGCCTTCTGAACCAGAAAG No data
Right 1135498659 16:22974846-22974868 CTGAATATACAGGTGGACAAAGG No data
1135498656_1135498659 5 Left 1135498656 16:22974818-22974840 CCAGTGGGGAGCTCTGGGAATTG No data
Right 1135498659 16:22974846-22974868 CTGAATATACAGGTGGACAAAGG No data
1135498653_1135498659 14 Left 1135498653 16:22974809-22974831 CCAGAAAGTCCAGTGGGGAGCTC No data
Right 1135498659 16:22974846-22974868 CTGAATATACAGGTGGACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135498659 Original CRISPR CTGAATATACAGGTGGACAA AGG Intergenic
No off target data available for this crispr