ID: 1135507667 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 16:23052809-23052831 |
Sequence | CAAGGACCCCCTTAGCTCCA TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1135507667_1135507673 | 21 | Left | 1135507667 | 16:23052809-23052831 | CCATGGAGCTAAGGGGGTCCTTG | No data | ||
Right | 1135507673 | 16:23052853-23052875 | GCACCCACCTCTGTCACTAAAGG | No data | ||||
1135507667_1135507670 | -1 | Left | 1135507667 | 16:23052809-23052831 | CCATGGAGCTAAGGGGGTCCTTG | No data | ||
Right | 1135507670 | 16:23052831-23052853 | GAGCCAGGAACTCTTCTACCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1135507667 | Original CRISPR | CAAGGACCCCCTTAGCTCCA TGG (reversed) | Intergenic | ||