ID: 1135507667

View in Genome Browser
Species Human (GRCh38)
Location 16:23052809-23052831
Sequence CAAGGACCCCCTTAGCTCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135507667_1135507673 21 Left 1135507667 16:23052809-23052831 CCATGGAGCTAAGGGGGTCCTTG No data
Right 1135507673 16:23052853-23052875 GCACCCACCTCTGTCACTAAAGG No data
1135507667_1135507670 -1 Left 1135507667 16:23052809-23052831 CCATGGAGCTAAGGGGGTCCTTG No data
Right 1135507670 16:23052831-23052853 GAGCCAGGAACTCTTCTACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135507667 Original CRISPR CAAGGACCCCCTTAGCTCCA TGG (reversed) Intergenic