ID: 1135507669

View in Genome Browser
Species Human (GRCh38)
Location 16:23052827-23052849
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135507669_1135507673 3 Left 1135507669 16:23052827-23052849 CCTTGAGCCAGGAACTCTTCTAC No data
Right 1135507673 16:23052853-23052875 GCACCCACCTCTGTCACTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135507669 Original CRISPR GTAGAAGAGTTCCTGGCTCA AGG (reversed) Intergenic