ID: 1135507671

View in Genome Browser
Species Human (GRCh38)
Location 16:23052834-23052856
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135507671_1135507673 -4 Left 1135507671 16:23052834-23052856 CCAGGAACTCTTCTACCAGGCAC No data
Right 1135507673 16:23052853-23052875 GCACCCACCTCTGTCACTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135507671 Original CRISPR GTGCCTGGTAGAAGAGTTCC TGG (reversed) Intergenic