ID: 1135507673

View in Genome Browser
Species Human (GRCh38)
Location 16:23052853-23052875
Sequence GCACCCACCTCTGTCACTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135507669_1135507673 3 Left 1135507669 16:23052827-23052849 CCTTGAGCCAGGAACTCTTCTAC No data
Right 1135507673 16:23052853-23052875 GCACCCACCTCTGTCACTAAAGG No data
1135507667_1135507673 21 Left 1135507667 16:23052809-23052831 CCATGGAGCTAAGGGGGTCCTTG No data
Right 1135507673 16:23052853-23052875 GCACCCACCTCTGTCACTAAAGG No data
1135507671_1135507673 -4 Left 1135507671 16:23052834-23052856 CCAGGAACTCTTCTACCAGGCAC No data
Right 1135507673 16:23052853-23052875 GCACCCACCTCTGTCACTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135507673 Original CRISPR GCACCCACCTCTGTCACTAA AGG Intergenic
No off target data available for this crispr