ID: 1135508054

View in Genome Browser
Species Human (GRCh38)
Location 16:23056193-23056215
Sequence TCTTATGTAAGATGACCTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135508053_1135508054 14 Left 1135508053 16:23056156-23056178 CCACAAATATGTGTTGAACGATT No data
Right 1135508054 16:23056193-23056215 TCTTATGTAAGATGACCTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135508054 Original CRISPR TCTTATGTAAGATGACCTGA AGG Intergenic
No off target data available for this crispr