ID: 1135508764

View in Genome Browser
Species Human (GRCh38)
Location 16:23062783-23062805
Sequence ACAAGGGCCCTTCTGATTCA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 123}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135508764 Original CRISPR ACAAGGGCCCTTCTGATTCA AGG (reversed) Exonic
902532869 1:17101638-17101660 AGCAGGGCCCTTCTCATTCTTGG - Intronic
903121876 1:21221503-21221525 CCCAGGGCCCTTCTGGTTCTAGG - Intronic
905358930 1:37404848-37404870 ACAAAAGCCCTTCTGCTTCCAGG + Intergenic
907724692 1:57008196-57008218 ACCAGGGCCATTCTGATTATGGG + Intronic
908076041 1:60518873-60518895 ACAAGGGCATGTGTGATTCAGGG + Intergenic
921592409 1:217020101-217020123 ACCAGGACCTTTGTGATTCAGGG - Intronic
1066495596 10:35938926-35938948 ACAAGGGCAGTCCAGATTCAGGG - Intergenic
1071203637 10:83249644-83249666 ACAAGGACCCTCCTGCCTCAGGG + Intergenic
1071360100 10:84837997-84838019 ACATGGGCCCTGCTAAGTCACGG + Intergenic
1074928383 10:118097489-118097511 AGAAGGGCCATTTTAATTCAGGG + Intergenic
1075487013 10:122830622-122830644 ACAAGTGATCTTATGATTCATGG + Intergenic
1077549702 11:3194576-3194598 ACCAGGCCCCTTCTGAGACAGGG + Intergenic
1077951529 11:6962950-6962972 ACAAGGGCCCTTCAGAAACAAGG - Intronic
1079720855 11:23812081-23812103 ACAAAGACCCTGCTCATTCAGGG - Intergenic
1085057479 11:73414456-73414478 AACAGGCACCTTCTGATTCAGGG - Intronic
1094647736 12:32343179-32343201 ACAGGGTCCCTTTTGAGTCAAGG - Intronic
1096393325 12:51246707-51246729 CCAAGGGACCTTCTGGATCAAGG - Intronic
1097643177 12:62205866-62205888 AAAGGGGATCTTCTGATTCATGG + Intronic
1100383621 12:94085159-94085181 ACATTGGCCCTTCTGGTTCTTGG + Intergenic
1100607973 12:96167438-96167460 GCAAGGGCCCTTCTAATCCAAGG + Intergenic
1102450191 12:113036402-113036424 CCAAGGGCACTTCTGACTGAAGG + Intergenic
1103984324 12:124757238-124757260 ACAAGGCCATTTCAGATTCAAGG - Intergenic
1104451601 12:128873413-128873435 ACGAGGGCCCTGCGGATGCACGG + Intronic
1104811164 12:131621156-131621178 ACAAGGGCCCTTGTTGTTCCTGG + Intergenic
1107893668 13:44937054-44937076 ACAAGCTCCCTTCTCAGTCAAGG + Intergenic
1109405437 13:61892432-61892454 ACAAGGGCCCTCCTGTCTGAAGG + Intergenic
1110657091 13:78012813-78012835 ACAAATGCCATTTTGATTCATGG - Intergenic
1113884557 13:113651839-113651861 CCAAGGGCCCTTCTCAGTCCTGG - Intronic
1116728665 14:48594511-48594533 ACAGGGGCTTTTCAGATTCAAGG - Intergenic
1117225130 14:53650478-53650500 ACAAGGGACTTTTTAATTCATGG - Intergenic
1118046229 14:61974357-61974379 ACAAGGGCCCTTCTAAGTGTAGG - Intergenic
1121227124 14:92329126-92329148 ACAAGGCACCCTCTAATTCATGG - Intronic
1123976624 15:25559862-25559884 GCCAGTGCCCTTGTGATTCAGGG - Intergenic
1124380556 15:29161427-29161449 ACAAGGGACTTTATTATTCATGG - Intronic
1124964719 15:34424287-34424309 AGGAGGGCCTTTCTGCTTCATGG - Intronic
1124981335 15:34570513-34570535 AGGAGGGCCTTTCTGCTTCATGG - Intronic
1125775694 15:42211179-42211201 AAAAGGGCCCTTCTGAGTTAAGG - Exonic
1128796309 15:70469263-70469285 ACCAGGGACCTGCTGATTCTTGG + Intergenic
1129232425 15:74204188-74204210 ACACTGGCCCTTCTGATCCCAGG + Intronic
1130992874 15:88887050-88887072 ACAAGGGCCCTGCTGGAACAGGG + Intronic
1133673551 16:8047700-8047722 TCTAGGGCCCTTCTGGCTCAGGG + Intergenic
1135508764 16:23062783-23062805 ACAAGGGCCCTTCTGATTCAAGG - Exonic
1135940377 16:26817094-26817116 ACATGGGCCTTTCAGGTTCAAGG + Intergenic
1139132520 16:64163519-64163541 AATAGGGCCTTTCTGTTTCAAGG + Intergenic
1140039603 16:71397259-71397281 ACAGGGGCCCTTCTGTGTGAGGG + Intergenic
1142000432 16:87661220-87661242 ACAAGGACCCTTGTGGTTCGGGG + Intronic
1143355827 17:6327728-6327750 ACAGTGGCCCTTGTGAGTCAGGG - Intergenic
1143390886 17:6558549-6558571 TCAAGGGCCCTCCTGCTTCTGGG + Intergenic
1149342404 17:55700325-55700347 ACAGGAGCCATTCTGATTCTTGG - Intergenic
1149668099 17:58380370-58380392 TCTAGGGCCCTTCTGAGGCATGG + Intronic
1151813464 17:76458983-76459005 AAAACGGCCCTTCTCATTCCTGG + Intronic
1151886263 17:76924938-76924960 AGAAGAGCCCTTCAGATTCTGGG - Intronic
1152730444 17:81967275-81967297 AGAAGGGTCCTTCTGATGGATGG - Intergenic
1153766329 18:8378494-8378516 CCAAGGAACCTTGTGATTCAAGG - Intronic
1157758096 18:50236430-50236452 ACAAGGCCCATCCTGATTCAAGG - Intronic
1167193351 19:48007739-48007761 GCAAGGGCCCTTCTCATTGTTGG - Intronic
1167347525 19:48955577-48955599 ACAGGGGCCCTTTTGCTTCAGGG + Exonic
926872332 2:17435597-17435619 AAAAGGGGCCTTCTGGTTCAAGG + Intergenic
927103954 2:19808426-19808448 ACAAGCTCCCTTCTCCTTCACGG + Intergenic
927125102 2:20006602-20006624 CCAAGGGCCCTCATGATTCCTGG + Intronic
929804792 2:45135643-45135665 ACCAGGGTCCCTCAGATTCAAGG - Intergenic
929903450 2:46025724-46025746 GCAAGGTCCCATCTGATTCAAGG + Intronic
932504725 2:72217596-72217618 ACAGGGGCCCTCCTTGTTCAAGG + Intronic
937247568 2:120503446-120503468 ACAAGGGCGCAGCTGATTCTGGG - Intergenic
939834044 2:147106382-147106404 ACATTGGCACTTCTGATTCTTGG - Intergenic
941240417 2:163029461-163029483 ACCAGGGCCCTGCTACTTCAGGG - Intergenic
942448676 2:176095059-176095081 AGAAGTGCCATTCTGATTTAAGG + Exonic
945803777 2:214465388-214465410 ACATGTTCCCTTCTGACTCAGGG + Intronic
946056487 2:216907008-216907030 CCAAGGGCCATTCTGTTACATGG - Intergenic
946155037 2:217801732-217801754 ACCAGAGCCCTTCTGTGTCACGG - Exonic
947390674 2:229636273-229636295 ACAGGGGTGCTTCTGACTCAGGG - Intronic
947437777 2:230087687-230087709 AGTTGGGCCATTCTGATTCAAGG + Intergenic
948227337 2:236321594-236321616 ACAAAGGGCCCTCTGATCCATGG + Intergenic
1169860121 20:10142295-10142317 ACAAGTGCACTCCTGACTCAGGG - Intergenic
1174625504 20:51911250-51911272 ACAAGTGCCCATTTGATTTAGGG - Intergenic
1177289047 21:19086430-19086452 ACAAGGACACTTGTGATTTAGGG - Intergenic
1177658094 21:24045944-24045966 ACAAGGCCAGCTCTGATTCAGGG - Intergenic
1184143935 22:42597238-42597260 ACGGGGGCCCTGCTGATTTAGGG + Intronic
1184307817 22:43618853-43618875 AAAAGGGGCCCTGTGATTCAAGG + Intronic
1184919356 22:47594728-47594750 ACCAGGGACCCTCTCATTCAAGG - Intergenic
950860725 3:16145436-16145458 ACATGGGCCCTTCTGACCCCAGG + Intergenic
953758802 3:45670699-45670721 ACAAAGCCAGTTCTGATTCAAGG + Intronic
953964169 3:47289972-47289994 ACAAGGGCAGTTTTGATACATGG - Intronic
954052931 3:47996452-47996474 ACAAGGACCCCTCTGAGGCACGG + Intronic
956906654 3:73772821-73772843 AAAAGGCACCTTCTGATTGAAGG + Intergenic
961493836 3:127276202-127276224 ATTAGGGCCCTTCTGCTTCATGG + Intergenic
963056862 3:141193291-141193313 ACAAGGGATATCCTGATTCAAGG - Intergenic
963850969 3:150210218-150210240 AATAGGGCCCTTCTCATTCCTGG + Intergenic
965498223 3:169424736-169424758 ACAAGGGGGTTTCTGAGTCATGG - Intronic
968845121 4:3036707-3036729 AGGAGGGACCTGCTGATTCAGGG + Intronic
969763638 4:9211053-9211075 ACAAGGGCCCTCCACATTCCTGG + Exonic
970571302 4:17385696-17385718 ACAAGGCCACTCCTGATTCAAGG + Intergenic
975377223 4:73659565-73659587 ACAAAGACCCATTTGATTCAAGG + Intergenic
975668661 4:76758067-76758089 TCAGAGGCTCTTCTGATTCAAGG + Intronic
976347761 4:84025044-84025066 ACATGGTCTCTTCTGACTCACGG - Intergenic
977173598 4:93792771-93792793 ACAAGGGCATTTGTGATCCATGG + Intergenic
979205734 4:118034764-118034786 ACAAAGGACCGTCTCATTCAGGG + Intronic
979482492 4:121236041-121236063 ACAAGGGCATTCCAGATTCAAGG + Intergenic
981576645 4:146212926-146212948 GCGAGGGCCCTGCTGACTCAGGG - Intergenic
983014948 4:162602084-162602106 ACAAGGACCCTTGTGCTTCCTGG + Intergenic
986060819 5:4188491-4188513 ACAAGGGAGCTGCTGCTTCAAGG + Intergenic
987311246 5:16683083-16683105 ACAAGAGCCCTTCTGAACCATGG - Intronic
988536090 5:32070508-32070530 CCAAAGTCCCTTCTGCTTCATGG + Intronic
991025048 5:62020073-62020095 ACAAGGCCAGTTCAGATTCAAGG - Intergenic
993551032 5:89274059-89274081 ACAAGGCCCCTTCTCATTCAGGG - Intergenic
997030496 5:130121889-130121911 AGACTGGCCCTCCTGATTCATGG + Intronic
1000129020 5:158276883-158276905 AAAAGGGGCCATCTAATTCATGG + Intergenic
1001396264 5:171421092-171421114 CCAAGCCCTCTTCTGATTCACGG - Intronic
1003552502 6:7111016-7111038 ACAAGCGACCTTTTGATTGAAGG + Intronic
1007821637 6:44564793-44564815 ACAAGGGACATTCAGACTCAAGG - Intergenic
1008617715 6:53242253-53242275 ACCAGGTCCCTTCTGCTTCTGGG + Intergenic
1009488269 6:64253684-64253706 GCAAGGGTCCTGCTGGTTCAGGG - Intronic
1010032179 6:71282499-71282521 ACAAGTGCCCTTCTGAGCCAGGG + Intergenic
1013051664 6:106541861-106541883 ACAATGACCCTTCTGAGCCATGG - Intronic
1016696421 6:147001368-147001390 ACATGGTCCCTTCTGAATTATGG - Intergenic
1016881723 6:148918023-148918045 ACAATGCCCCTTCTGGTGCATGG - Intronic
1019649456 7:2148848-2148870 ACAAGAACCCTCCTGATCCAAGG + Intronic
1026870986 7:73851549-73851571 AGAAGGGCACTACTGAATCAGGG + Intergenic
1039357754 8:36839958-36839980 TCAAGGGCCATCCTGATGCATGG - Intronic
1041632725 8:60106169-60106191 ACAAGGGCACTCCAAATTCAAGG + Intergenic
1041871847 8:62643670-62643692 ACAATGGACCTTCTGAAGCAGGG - Intronic
1047632241 8:126721081-126721103 ACAAGAGACCTTCTCAATCAAGG - Intergenic
1047775764 8:128069034-128069056 TCCAGGGTCCTTCTGTTTCACGG + Intergenic
1057224075 9:93277935-93277957 ACAAGGGCCCTTTTTATTGTTGG - Intronic
1058622424 9:106897823-106897845 AGCAGGGCCCTGCTGATCCATGG + Intronic
1059678260 9:116561309-116561331 CCAAGGGCCCTTTTCAGTCAAGG - Intronic
1060284658 9:122238546-122238568 ACAAGGGAGCTTCTACTTCAAGG - Exonic
1185826701 X:3258031-3258053 CCTACGTCCCTTCTGATTCAGGG + Intergenic
1187392632 X:18896032-18896054 ACAGGGGCCCCTGTGCTTCATGG - Intronic
1187700963 X:21963923-21963945 AGAATGGCTCTTCAGATTCAGGG + Intronic
1188093031 X:25987176-25987198 ATAAGGGCACTGCTGGTTCATGG - Intergenic
1197339532 X:125249075-125249097 CCAAGTGCCCTTCTCTTTCAAGG + Intergenic
1198114428 X:133531436-133531458 ACAAGTGCAGTTTTGATTCATGG + Intergenic
1199357373 X:146877240-146877262 ACATGGGCCCTTCTCTTCCATGG + Intergenic
1199705688 X:150422907-150422929 CCAAGGGGCTTTCTGGTTCAAGG + Intronic
1201252176 Y:12070280-12070302 TCTACGTCCCTTCTGATTCAGGG - Intergenic