ID: 1135510600

View in Genome Browser
Species Human (GRCh38)
Location 16:23079884-23079906
Sequence CCTTCAGACGGGTTTGCTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 62
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 60}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135510600 Original CRISPR CCTTCAGACGGGTTTGCTTG TGG (reversed) Intronic
900216051 1:1482244-1482266 CCTTCAGGCGGATCTGCTCGCGG - Exonic
900223171 1:1520247-1520269 CCTTCAGGCGGATCTGCTCGCGG - Exonic
909415778 1:75403671-75403693 CCTTCAGATGGGTTTTTGTGTGG - Intronic
912978988 1:114353632-114353654 CCTTTAGTCTGGTTTGCTTAAGG + Intergenic
922451185 1:225738696-225738718 CTTCCTGACAGGTTTGCTTGGGG + Intergenic
923663488 1:235979028-235979050 CATACAGCCGGGTCTGCTTGTGG + Exonic
1064437536 10:15324298-15324320 CGCTCAGCAGGGTTTGCTTGGGG + Intronic
1074525335 10:114258121-114258143 GCTGCAGAAGGGTTTGCATGAGG + Intronic
1080217478 11:29861826-29861848 CCTTCAGAAGGTTCTCCTTGTGG - Intergenic
1083279814 11:61620018-61620040 CCTTGAGACGGGTTTGGAAGAGG - Intergenic
1084757924 11:71251282-71251304 CCTCCAGGCGGGTCTGCGTGCGG - Intronic
1085458183 11:76677636-76677658 CCTTCAGAGGGATTGGCTTGGGG - Intergenic
1086452658 11:86932429-86932451 CCTCCAGAAGAGTTTGCTGGGGG + Intronic
1086505409 11:87498671-87498693 CCTTCAGATGGGGTTTTTTGTGG - Intergenic
1088557079 11:111072774-111072796 CCTTTAGAGGAGCTTGCTTGTGG + Intergenic
1091229343 11:133977609-133977631 GCTTCAGACGGTGTTTCTTGTGG + Intergenic
1093092460 12:14937005-14937027 CCTTCAGATGGAATTGCTGGAGG + Intronic
1095032642 12:37313101-37313123 CCTTTAGAGGGATCTGCTTGTGG + Intergenic
1095810774 12:46371974-46371996 CCTGTGGACGGGTGTGCTTGAGG - Intronic
1105433660 13:20359511-20359533 CCTTCCATTGGGTTTGCTTGGGG + Intergenic
1105684337 13:22763567-22763589 CTTTCACACGGGTTTGCAGGAGG + Intergenic
1108286129 13:48909740-48909762 ATTTCAGACAGGCTTGCTTGGGG - Intergenic
1113037908 13:106071225-106071247 CCTTTAGAAGTGATTGCTTGTGG - Intergenic
1129267763 15:74403217-74403239 CCTGCAGAAGGGTTTCCTGGTGG - Intergenic
1129406491 15:75322594-75322616 CCGTCAGAAGGGTTTGTTCGCGG + Intergenic
1132679744 16:1134860-1134882 CCTTCAGAGGGGCGGGCTTGAGG - Intergenic
1134018217 16:10903973-10903995 CCTACAGGCAGCTTTGCTTGTGG - Intronic
1135172110 16:20194075-20194097 CCATCAGAATGGTTTTCTTGGGG - Intergenic
1135510600 16:23079884-23079906 CCTTCAGACGGGTTTGCTTGTGG - Intronic
1135794938 16:25432720-25432742 CATTTAGACTGGTTTGCTTTGGG + Intergenic
1137778301 16:51075012-51075034 CCTGCAGATGGGGATGCTTGAGG - Intergenic
1138328500 16:56193706-56193728 CCCACAGGCAGGTTTGCTTGGGG + Intronic
1142123060 16:88396673-88396695 CCTTCAGACGGGTCTCCTCCCGG - Intergenic
1142123136 16:88396916-88396938 CCTTCAGACGGGTCTCCTCCCGG - Intergenic
1145818217 17:27810882-27810904 CCTTCTGTGGGGTTTGCCTGGGG - Intronic
940096090 2:149977866-149977888 CCTTCAGAAGGACCTGCTTGAGG - Intergenic
944259155 2:197657267-197657289 CCTTCAGACAGGTCTCCTTTGGG - Intronic
1177955727 21:27596179-27596201 ACTTCAGATGTGTTTGCTTAAGG + Intergenic
959026489 3:101245844-101245866 GCTTCAGACTGGCTTGCCTGTGG - Exonic
961345058 3:126258898-126258920 CCTGCAGAAGGGCTTGCCTGAGG - Intergenic
962620537 3:137173703-137173725 TCCTCAGATGGGTTTGCTTTTGG + Intergenic
970600267 4:17636557-17636579 CCTTCAGGCGGGTCTGCAGGCGG + Exonic
976117234 4:81740935-81740957 CCATCAGAGGTTTTTGCTTGGGG - Intronic
978200674 4:106020655-106020677 CCTTAAGATAGGTTTTCTTGAGG + Intergenic
978829010 4:113060172-113060194 TGTTCAAACGGGTTTGATTGAGG - Intronic
981484388 4:145270112-145270134 CCTTCAAAGGGGTTTGCCTTAGG + Intergenic
985674005 5:1220972-1220994 CCCACAGAGGGGTCTGCTTGAGG + Intronic
991643550 5:68777793-68777815 CCTTCAGACTTCTCTGCTTGGGG - Intergenic
1007714385 6:43846595-43846617 CCTTCTGACGGGCCTGCCTGAGG + Intergenic
1021207979 7:17807930-17807952 CCTTCAGATGGGTTTCTGTGTGG - Intronic
1029193904 7:98791079-98791101 CATTCAGGAGGGTTTGCTGGTGG - Intergenic
1030696337 7:112588871-112588893 CCTTCAGATTGGTTTTTTTGTGG - Intergenic
1032195730 7:129787226-129787248 CCTCCAGATGGGCTAGCTTGGGG + Intergenic
1035349531 7:158236471-158236493 CCTTCGGGCAGCTTTGCTTGAGG - Intronic
1040957879 8:52997868-52997890 CCTTCAGATGGGTTTGCAGTTGG + Intergenic
1052061444 9:23965829-23965851 CCTTCAGATGGGTTTTTGTGTGG + Intergenic
1052613206 9:30802418-30802440 ACTTCAGAAGGTTTTGTTTGAGG - Intergenic
1057772848 9:97983449-97983471 CCGTCGGAAGGGTTTGCTAGCGG - Exonic
1058266746 9:102909086-102909108 CATTCACATGTGTTTGCTTGAGG + Intergenic
1060870138 9:127033365-127033387 CCTTCAGACGTGACTGCTAGTGG + Intronic
1061304998 9:129727017-129727039 CTTAGAGACGGGTTTGCTGGGGG - Intergenic
1198087881 X:133297589-133297611 CTGTCAGAGGGGTGTGCTTGGGG - Intergenic