ID: 1135511195

View in Genome Browser
Species Human (GRCh38)
Location 16:23084981-23085003
Sequence ACAAATAAGCTGCAATTAGG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 168}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135511189_1135511195 29 Left 1135511189 16:23084929-23084951 CCTTTGCAGACGAACACTTTCTG 0: 1
1: 0
2: 0
3: 3
4: 81
Right 1135511195 16:23084981-23085003 ACAAATAAGCTGCAATTAGGGGG 0: 1
1: 0
2: 0
3: 9
4: 168
1135511188_1135511195 30 Left 1135511188 16:23084928-23084950 CCCTTTGCAGACGAACACTTTCT 0: 1
1: 0
2: 1
3: 12
4: 118
Right 1135511195 16:23084981-23085003 ACAAATAAGCTGCAATTAGGGGG 0: 1
1: 0
2: 0
3: 9
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135511195 Original CRISPR ACAAATAAGCTGCAATTAGG GGG Exonic
903990539 1:27265200-27265222 ACAAAGAAGCTGGAATTGGAAGG - Intronic
911255731 1:95631017-95631039 ACAAAATATCTGGAATTAGGTGG + Intergenic
912034756 1:105299045-105299067 ACATATAAGCTGAAAATAGAAGG - Intergenic
912489210 1:110052421-110052443 ATAAAAAAGATACAATTAGGTGG - Intronic
912610731 1:111040563-111040585 AAAAAAAAGTTGCAGTTAGGCGG + Intergenic
915444181 1:155965504-155965526 ACAAATAAGGAGAACTTAGGGGG - Intronic
920202310 1:204267101-204267123 ACACACAAGCTCCAATTAGTAGG + Intronic
921949909 1:220918725-220918747 TCATATAAGCTGCAGATAGGTGG - Intergenic
924256505 1:242188539-242188561 AGAAAGCAGCTGCAGTTAGGAGG + Intronic
924515099 1:244759613-244759635 GGAAATAAACTGCAATTAGAAGG + Intergenic
1063389733 10:5641465-5641487 ACAACTAATCTGCAGCTAGGAGG + Intronic
1063834938 10:10001933-10001955 ACAAATAACCAACAACTAGGGGG + Intergenic
1071038382 10:81276006-81276028 ACAAAAAAGATGAAATTAGGTGG + Intergenic
1072257091 10:93630874-93630896 ACAAATAAGCTTCAATTGCAAGG - Intronic
1073161253 10:101398195-101398217 ACAAATAAGGTGGAAGAAGGTGG + Intronic
1076173547 10:128344508-128344530 ACAAATAAGCTGAAAATAAAAGG - Intergenic
1078784485 11:14475212-14475234 ACAGGTAAGCTGGAATTCGGAGG - Intronic
1080950993 11:37032677-37032699 ACAGATAAGCAGCATTTAGAGGG + Intergenic
1084866531 11:72062748-72062770 ACAAATAAGCAGGTATTAAGTGG + Intronic
1085926082 11:81023148-81023170 TGAAATAAACTGAAATTAGGTGG + Intergenic
1085936935 11:81157753-81157775 ATAAATAACCTTGAATTAGGTGG + Intergenic
1087327531 11:96742004-96742026 ACAAATAAGAAGCAATGAGTGGG - Intergenic
1089010308 11:115126863-115126885 ACAAATAAGGTGAAATTATTAGG + Intergenic
1090156101 11:124440335-124440357 ACAGAGAAACTGCAATTATGTGG + Exonic
1092885351 12:12919981-12920003 ACAAATATGTTGCAATAAGCTGG + Intergenic
1093063306 12:14630083-14630105 AAAAAAAAGCTGCAAACAGGTGG - Intronic
1094723213 12:33086250-33086272 ACAAATAAGGTCCAATGAGAAGG - Intergenic
1096014960 12:48262370-48262392 AAAAAGAAGCTGCAGTTATGAGG - Intergenic
1099732152 12:86518812-86518834 ACAGATAAGCTACAATGAGTTGG - Intronic
1099925450 12:89011105-89011127 ACAAATTAGCAACAATTGGGTGG + Intergenic
1099964225 12:89428288-89428310 ACAGTTAAGCTGAAATTTGGAGG - Intronic
1103758218 12:123227724-123227746 ACAAATGAGGTGCCATTAGAAGG - Intronic
1103859832 12:124003384-124003406 AAAAAAAAGATGCAATTAGATGG - Intronic
1105061318 12:133153733-133153755 ACAAAGAACCAGCAGTTAGGTGG + Intronic
1106515456 13:30449419-30449441 ACAAAAAATCAGCAATTAGCTGG + Intergenic
1106779910 13:33048770-33048792 ACAAATAAGCTGCTTTTAAATGG - Intronic
1107051909 13:36059707-36059729 ACAAATATGCTACAAGTAGTTGG + Intronic
1108916260 13:55615930-55615952 ATAAATATGGTGCAATTAGTGGG - Intergenic
1109517293 13:63460293-63460315 ACAAATGAGATGGCATTAGGAGG - Intergenic
1109645361 13:65246940-65246962 ACTAATAAACTGCTATTATGTGG - Intergenic
1109764494 13:66876366-66876388 ACAAATAATCTTGAATTAGAAGG + Intronic
1114755207 14:25252035-25252057 ACAAATATGCTACAAAGAGGAGG - Intergenic
1114799164 14:25752871-25752893 ACACATAAGATGCAATTAGATGG + Intergenic
1115316365 14:32028957-32028979 AGAAATAAACTGGAATTTGGGGG + Intergenic
1116573037 14:46542850-46542872 ACAAATTAGCTTAAATTGGGTGG + Intergenic
1118005256 14:61559706-61559728 GCAAAAAAGCTGCAATTCAGGGG - Intronic
1119810002 14:77509174-77509196 ACAAATAAGCAGTACTTTGGGGG + Exonic
1120747156 14:88162895-88162917 AGAATAAAGCTGCAATTTGGAGG + Intergenic
1124118904 15:26871537-26871559 ACATATTTGCTGCAATTAGTCGG - Intronic
1126282301 15:46968316-46968338 ACAAATAAGCTGAAAGTAAAAGG + Intergenic
1130751189 15:86714849-86714871 ACAAGGAAGCTCCAAATAGGAGG - Intronic
1133698635 16:8288488-8288510 GGAAAGAGGCTGCAATTAGGGGG - Intergenic
1133705761 16:8353246-8353268 ACACATAAGCTGCAAGAATGAGG + Intergenic
1134467691 16:14494017-14494039 AAAAATAATCTGCATATAGGCGG - Intronic
1135511195 16:23084981-23085003 ACAAATAAGCTGCAATTAGGGGG + Exonic
1137268659 16:46888003-46888025 AAAAATAAGCTGCAATTAAAAGG + Intronic
1137400473 16:48149482-48149504 ACAAATAAGCTAAAAGTAGCAGG + Intronic
1137573917 16:49585636-49585658 ACAAATTACCGGCAATTAGCCGG + Intronic
1137860458 16:51841628-51841650 AATAATAATCTGCAATTTGGAGG + Intergenic
1140669410 16:77261359-77261381 ACAAATAAGTTGAAATTAAGAGG - Intronic
1140794615 16:78425653-78425675 ACAAATATGCTGAAAATACGAGG - Intronic
1141352055 16:83307056-83307078 ACATATAAGCTACAGTTGGGTGG + Intronic
1153534667 18:6088129-6088151 ACAAATAAGCTGCTGATATGTGG + Intronic
1154509273 18:15078111-15078133 ACAAATCAGCTGCAATGTTGTGG - Intergenic
1155281264 18:24242312-24242334 ACAAAAAAGATTCAGTTAGGGGG + Intronic
1155532465 18:26781221-26781243 ACCAACAAGCTGCAAATATGTGG - Intergenic
1159031108 18:63233184-63233206 CCAAATACGATGCTATTAGGAGG - Intronic
1161122036 19:2533620-2533642 AAAAAACAGCAGCAATTAGGTGG + Intronic
1163450655 19:17375263-17375285 ACACACAAGCTGCAAATAAGTGG - Intronic
1165353332 19:35289157-35289179 ACAAATAAACTGCAGATAGCTGG + Intergenic
1166946109 19:46397513-46397535 TAAAATAGGCTCCAATTAGGGGG - Intergenic
1167990265 19:53354686-53354708 ACAAATAAACTGAATTAAGGAGG - Exonic
930303617 2:49649584-49649606 AGAAATAAACTGAAATTAAGCGG - Intergenic
930651941 2:53971704-53971726 ACAAAGAAGTTGAAACTAGGGGG + Intronic
932383787 2:71311721-71311743 ACAAACAAGCTGAAAGTAAGAGG - Intronic
933320828 2:80773707-80773729 ACCAATAAGATGGTATTAGGAGG + Intergenic
936429502 2:112450072-112450094 ACAAAAAAGGGGCAAATAGGAGG - Intergenic
938043589 2:128096671-128096693 ACAAATAAGTTGACATTACGAGG + Intronic
938831042 2:135050524-135050546 ACAAATAAGCTCCTAACAGGGGG + Intergenic
941049938 2:160721559-160721581 ACAGATATGCTGAAATGAGGAGG + Intergenic
941314698 2:163978129-163978151 AAAAATAATCTGCATTTTGGTGG + Intergenic
941503902 2:166315785-166315807 ACAAAGAAGATGCAATGATGGGG + Intronic
942870509 2:180728734-180728756 AGAAATAAGCTGGATTTATGAGG + Intergenic
943487788 2:188508944-188508966 ACTAATAAGCTGCAGTTCAGTGG + Intronic
943594578 2:189840858-189840880 ATAAATAATCTGCTTTTAGGAGG - Intronic
944866461 2:203867284-203867306 AGAAATAAACTGAAAATAGGCGG - Intergenic
946887931 2:224242992-224243014 ACCAATTAGGTGCTATTAGGTGG - Intergenic
1170008268 20:11692769-11692791 ACAAATTAGCAGAAACTAGGTGG + Intergenic
1170972688 20:21131055-21131077 GCAATTTAGCTTCAATTAGGTGG + Intronic
1171772999 20:29340791-29340813 ACAAATAAGATGGAATTAGTAGG + Intergenic
1171815095 20:29779032-29779054 GCAAATAAGATGGAATTAGTAGG + Intergenic
1171981149 20:31630147-31630169 ACATTTAAGCTGCAATTTGAAGG + Intergenic
1172973756 20:38891646-38891668 AAAAATTAGCTGGAATTTGGTGG + Intronic
1174292921 20:49521697-49521719 AAAAATAAGCTGCAAGTCGATGG + Intronic
1174913194 20:54628725-54628747 ACACATTAGCTGCATTTTGGGGG - Intronic
1176788798 21:13293699-13293721 ACAAATCAGCTGCAATGTTGTGG + Intergenic
1178843816 21:36157628-36157650 ACAAGTCTGCTGCCATTAGGTGG + Intronic
1179803013 21:43820447-43820469 CCAAATAAGGTGGAATTTGGAGG - Intergenic
1180336740 22:11583648-11583670 TCAAATAAGATGGAATTAGTAGG - Intergenic
1182736830 22:32536786-32536808 ACAAAGAAGCTGAACTTGGGTGG + Intronic
1182793438 22:32972538-32972560 AGAAATGAGCTGAAATTATGTGG - Intronic
1184311133 22:43643781-43643803 ACAAACAAGCTGAAATTCAGTGG + Intronic
951115006 3:18850342-18850364 ACAAATAAGTTGCAAGAAGTAGG - Intergenic
951544630 3:23811497-23811519 GCAACTCACCTGCAATTAGGTGG - Exonic
952630729 3:35463065-35463087 ACCAAGAAGCTGAATTTAGGAGG - Intergenic
952844971 3:37680589-37680611 ACAACTAAACTGGAATGAGGAGG + Intronic
956532293 3:70233881-70233903 ACAAATATCCTTCAATTGGGTGG - Intergenic
958031203 3:88113254-88113276 ACCAATAAGCTATATTTAGGGGG - Intronic
959112765 3:102141833-102141855 AGAAATGAGCTGCATTTAGGAGG + Intronic
965297062 3:166961103-166961125 ACAAAAAAGATGGAATTTGGAGG - Intergenic
965715343 3:171596643-171596665 TGAAATAAGATGCAATTGGGTGG - Intergenic
966749252 3:183306259-183306281 AAAAATAAGCTTCAATTTGGAGG - Intronic
972299019 4:37767645-37767667 ACACACAAGCTGTAATTAGTAGG - Intergenic
972833008 4:42835743-42835765 ACCAATGGGATGCAATTAGGAGG + Intergenic
973768049 4:54181655-54181677 AAAAATTAGCTGGAATTAGCTGG - Intronic
974717809 4:65693552-65693574 AGAAATAAGCTGCCATTAAATGG - Intergenic
976471139 4:85430430-85430452 ACAAAAAAGCAGTAATTAGCAGG - Intergenic
976688179 4:87839164-87839186 AGAAGCAAGCTGCAATTTGGTGG - Intronic
977503655 4:97874965-97874987 ACAAATTACCTTCAATTGGGTGG - Intronic
977658177 4:99548619-99548641 ACATAAAAGCTGCAAATAGAGGG + Exonic
978835666 4:113146772-113146794 ATAAATAACTTGCAATAAGGTGG - Intronic
982914225 4:161184940-161184962 AGAAATAAGATTCAATTATGTGG + Intergenic
986303358 5:6496080-6496102 ACAAATAGAGTGCAATGAGGGGG + Intergenic
989007682 5:36833441-36833463 ACAAGTAGTCTGCAAGTAGGGGG - Intergenic
990052271 5:51518807-51518829 ACAGACAAGCTGCAATCACGGGG + Intergenic
990436563 5:55798090-55798112 AGAAATAAACTGCAATAAGCAGG - Intronic
991022034 5:61989326-61989348 AAAAGTAAGCTGCAATCAAGAGG + Intergenic
991028893 5:62061782-62061804 ATAAATACGTTGGAATTAGGAGG + Intergenic
995425997 5:112023390-112023412 ACAAATAAGCTGGAGTCTGGTGG - Intergenic
995657968 5:114448477-114448499 TCAAGCAAGGTGCAATTAGGAGG + Intronic
996925174 5:128816699-128816721 ACAAATAAAATGAAAATAGGGGG - Intronic
1001034632 5:168288886-168288908 AAAAAAAATCAGCAATTAGGAGG + Intergenic
1003326542 6:5096191-5096213 ACAAAGAAACTGCCACTAGGTGG + Intergenic
1005561263 6:27044268-27044290 ACAAACAATCTGCAATCAGCTGG - Intergenic
1006214223 6:32425747-32425769 AGAAATCAGCAGCAATTATGGGG - Intergenic
1008046931 6:46860614-46860636 ACAGAGAAGCTGCAATGGGGAGG + Intronic
1009270872 6:61612246-61612268 ACAAATAATATGCAATTCTGAGG - Intergenic
1011604582 6:89090391-89090413 ACAAATAAGCTGATCTTATGAGG + Intergenic
1013321102 6:108990472-108990494 AAAACTAAGCTGCAATAAAGTGG + Intronic
1013344234 6:109244482-109244504 AAAAATAAGTTTTAATTAGGAGG + Intergenic
1013978859 6:116106230-116106252 ATAAATGAGCTGCAAATAAGGGG - Exonic
1015812237 6:137172276-137172298 ACAAATGAGGGGAAATTAGGCGG + Intronic
1016506457 6:144786264-144786286 ACAAATAAGATGCATTCAGGTGG - Intronic
1017208674 6:151831434-151831456 AGAAATCACCTGCAATTAGCTGG - Intronic
1017355632 6:153503961-153503983 TCAAAGAAGCTGCCAGTAGGGGG - Intergenic
1018446739 6:163865328-163865350 ACAATGAAGCTTCAAATAGGTGG - Intergenic
1019941429 7:4294974-4294996 ACAAATAAGCTACTAGTAGCCGG - Intergenic
1020154608 7:5712318-5712340 AAAAATAAGCTGGAATGTGGTGG + Intronic
1026630758 7:72035912-72035934 ACAATAAAGGTGCAATTATGTGG - Intronic
1027879611 7:83817655-83817677 AAAATTAAGTTGCAATGAGGTGG - Intergenic
1027999439 7:85473293-85473315 ACAAATAAGATGCAAAAAAGAGG + Intergenic
1031500101 7:122503853-122503875 ATAAATGAATTGCAATTAGGAGG + Intronic
1031642149 7:124178450-124178472 ACCAATATGATGAAATTAGGAGG - Intergenic
1032126164 7:129194745-129194767 AGAAATAAGCTGCAATAACATGG - Intronic
1034017403 7:147601891-147601913 ACAAATAAACTTAAAATAGGGGG - Intronic
1034476897 7:151290165-151290187 ACAAATAAAATACAATTATGAGG - Intergenic
1034719603 7:153278276-153278298 ACAAATAGGCTAAAATTAAGGGG + Intergenic
1037251891 8:16905140-16905162 AAAGGTAAGCTTCAATTAGGAGG + Intergenic
1037626086 8:20608099-20608121 TCACATAAGATGCAATAAGGAGG - Intergenic
1038365318 8:26925953-26925975 ACAAAAAATCTGCAATGATGGGG + Intergenic
1040879834 8:52192677-52192699 ACAAAAAAGGTACAGTTAGGAGG + Intronic
1041448613 8:57982591-57982613 TCAAATAAGTTTCAAATAGGTGG - Intergenic
1041684101 8:60626501-60626523 ACAAAAAAGCTAATATTAGGGGG + Intergenic
1043011383 8:74885811-74885833 ACAAATAAATGGCAATTAGATGG + Intergenic
1043907972 8:85829595-85829617 CCAGATCAGCTGCAGTTAGGAGG + Intergenic
1046171315 8:110510725-110510747 ATAAATAAGATGCAATTATAGGG - Intergenic
1048190864 8:132287245-132287267 ACAAATAAGATGCCTTTAAGGGG + Intronic
1052342242 9:27375212-27375234 ACAAAGAAGCTGCAAGTATGAGG - Intronic
1058329086 9:103736603-103736625 AGAAAAAAGCTGGAAATAGGTGG - Intergenic
1059626494 9:116072734-116072756 ACAAAAAAACTGAAAGTAGGAGG - Intergenic
1185538929 X:886640-886662 ACAAATTATCTGCACTTAGAAGG - Intergenic
1191781258 X:64869008-64869030 ACAAATAAGTTGAAAGTAAGAGG - Intergenic
1195143578 X:101989466-101989488 ACAAATGAGCTGCCATCAGAAGG - Intergenic
1195607529 X:106825103-106825125 ACAAATAAATTGCAATTTTGTGG - Intronic
1197360211 X:125492453-125492475 AAAAATAAGCAACAATGAGGTGG + Intergenic
1197507345 X:127322532-127322554 AAAAAAAAGCTTCAATTATGAGG - Intergenic
1197825561 X:130586802-130586824 AGAAAAAAGATGTAATTAGGTGG + Intergenic
1201071920 Y:10154880-10154902 GCAAATAAGATGGAATTAGTAGG - Intergenic