ID: 1135512637

View in Genome Browser
Species Human (GRCh38)
Location 16:23100475-23100497
Sequence ACAAAGCAGAATAGTGGGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135512631_1135512637 18 Left 1135512631 16:23100434-23100456 CCATTTATATAGAAGTCTAGACT No data
Right 1135512637 16:23100475-23100497 ACAAAGCAGAATAGTGGGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135512637 Original CRISPR ACAAAGCAGAATAGTGGGCC GGG Intronic
No off target data available for this crispr