ID: 1135513900

View in Genome Browser
Species Human (GRCh38)
Location 16:23113296-23113318
Sequence TCTGATTCAAATTTCCAGCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135513900_1135513904 22 Left 1135513900 16:23113296-23113318 CCGAGCTGGAAATTTGAATCAGA No data
Right 1135513904 16:23113341-23113363 GACAGAACCCAGGGAACATATGG No data
1135513900_1135513903 13 Left 1135513900 16:23113296-23113318 CCGAGCTGGAAATTTGAATCAGA No data
Right 1135513903 16:23113332-23113354 ATCACATGAGACAGAACCCAGGG No data
1135513900_1135513902 12 Left 1135513900 16:23113296-23113318 CCGAGCTGGAAATTTGAATCAGA No data
Right 1135513902 16:23113331-23113353 TATCACATGAGACAGAACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135513900 Original CRISPR TCTGATTCAAATTTCCAGCT CGG (reversed) Intronic
No off target data available for this crispr