ID: 1135513902

View in Genome Browser
Species Human (GRCh38)
Location 16:23113331-23113353
Sequence TATCACATGAGACAGAACCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135513900_1135513902 12 Left 1135513900 16:23113296-23113318 CCGAGCTGGAAATTTGAATCAGA No data
Right 1135513902 16:23113331-23113353 TATCACATGAGACAGAACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135513902 Original CRISPR TATCACATGAGACAGAACCC AGG Intronic
No off target data available for this crispr