ID: 1135515797

View in Genome Browser
Species Human (GRCh38)
Location 16:23132446-23132468
Sequence CATTGTGACGAGTGTATAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135515793_1135515797 -5 Left 1135515793 16:23132428-23132450 CCTTATTTAGTAGCCCCTCATTG No data
Right 1135515797 16:23132446-23132468 CATTGTGACGAGTGTATAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135515797 Original CRISPR CATTGTGACGAGTGTATAGA TGG Intronic
No off target data available for this crispr