ID: 1135516426

View in Genome Browser
Species Human (GRCh38)
Location 16:23139349-23139371
Sequence TGGTGTGATTAGCGTGATCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135516426_1135516428 -6 Left 1135516426 16:23139349-23139371 CCGAGATCACGCTAATCACACCA No data
Right 1135516428 16:23139366-23139388 ACACCACTGCACTGCAGCCTGGG 0: 455
1: 24033
2: 105503
3: 198540
4: 216728
1135516426_1135516427 -7 Left 1135516426 16:23139349-23139371 CCGAGATCACGCTAATCACACCA No data
Right 1135516427 16:23139365-23139387 CACACCACTGCACTGCAGCCTGG 0: 459
1: 23496
2: 79873
3: 174759
4: 205057

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135516426 Original CRISPR TGGTGTGATTAGCGTGATCT CGG (reversed) Intronic
No off target data available for this crispr