ID: 1135523190

View in Genome Browser
Species Human (GRCh38)
Location 16:23193099-23193121
Sequence CAATCTAATACCTTGTGGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135523190_1135523194 9 Left 1135523190 16:23193099-23193121 CCAACCCACAAGGTATTAGATTG No data
Right 1135523194 16:23193131-23193153 TAATTGCTGTTTTTGTCATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135523190 Original CRISPR CAATCTAATACCTTGTGGGT TGG (reversed) Intronic
No off target data available for this crispr