ID: 1135524180

View in Genome Browser
Species Human (GRCh38)
Location 16:23201268-23201290
Sequence CAGTTTGAAAAGGGGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135524180_1135524187 17 Left 1135524180 16:23201268-23201290 CCCTCTTCCCCCTTTTCAAACTG No data
Right 1135524187 16:23201308-23201330 TTGTAAAAGTATAAGAACTAAGG 0: 1
1: 0
2: 1
3: 25
4: 324

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135524180 Original CRISPR CAGTTTGAAAAGGGGGAAGA GGG (reversed) Intronic
No off target data available for this crispr