ID: 1135526118

View in Genome Browser
Species Human (GRCh38)
Location 16:23214971-23214993
Sequence CCGACCCTGCACAGGCTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 245
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 215}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135526118_1135526131 8 Left 1135526118 16:23214971-23214993 CCTCCCAGCCTGTGCAGGGTCGG 0: 1
1: 0
2: 1
3: 28
4: 215
Right 1135526131 16:23215002-23215024 CGTGGCTCCCTTGGGAATCAGGG 0: 1
1: 0
2: 1
3: 8
4: 111
1135526118_1135526126 -1 Left 1135526118 16:23214971-23214993 CCTCCCAGCCTGTGCAGGGTCGG 0: 1
1: 0
2: 1
3: 28
4: 215
Right 1135526126 16:23214993-23215015 GGGCTGACCCGTGGCTCCCTTGG 0: 1
1: 0
2: 0
3: 8
4: 182
1135526118_1135526130 7 Left 1135526118 16:23214971-23214993 CCTCCCAGCCTGTGCAGGGTCGG 0: 1
1: 0
2: 1
3: 28
4: 215
Right 1135526130 16:23215001-23215023 CCGTGGCTCCCTTGGGAATCAGG 0: 1
1: 0
2: 1
3: 14
4: 153
1135526118_1135526135 30 Left 1135526118 16:23214971-23214993 CCTCCCAGCCTGTGCAGGGTCGG 0: 1
1: 0
2: 1
3: 28
4: 215
Right 1135526135 16:23215024-23215046 GTTCCTGTGTGAGGCCAACTTGG 0: 1
1: 0
2: 0
3: 8
4: 140
1135526118_1135526134 21 Left 1135526118 16:23214971-23214993 CCTCCCAGCCTGTGCAGGGTCGG 0: 1
1: 0
2: 1
3: 28
4: 215
Right 1135526134 16:23215015-23215037 GGAATCAGGGTTCCTGTGTGAGG 0: 1
1: 0
2: 1
3: 16
4: 199
1135526118_1135526125 -10 Left 1135526118 16:23214971-23214993 CCTCCCAGCCTGTGCAGGGTCGG 0: 1
1: 0
2: 1
3: 28
4: 215
Right 1135526125 16:23214984-23215006 GCAGGGTCGGGGCTGACCCGTGG 0: 1
1: 0
2: 2
3: 28
4: 288
1135526118_1135526127 0 Left 1135526118 16:23214971-23214993 CCTCCCAGCCTGTGCAGGGTCGG 0: 1
1: 0
2: 1
3: 28
4: 215
Right 1135526127 16:23214994-23215016 GGCTGACCCGTGGCTCCCTTGGG 0: 1
1: 0
2: 0
3: 9
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135526118 Original CRISPR CCGACCCTGCACAGGCTGGG AGG (reversed) Intronic
900072125 1:779165-779187 CCGACCCTACCCAGGATGAGCGG - Intergenic
900534561 1:3170556-3170578 CAGACCCTGCCCTGGCTGCGAGG + Intronic
900691027 1:3980698-3980720 ACGACCCTGCACACTCTGTGAGG - Intergenic
902516060 1:16990184-16990206 CTGACCCCGCTCAGGGTGGGTGG + Exonic
902627367 1:17684427-17684449 CTGACTTTGCACAGGCTGTGAGG + Intronic
903043936 1:20552406-20552428 GGGACCCTGCACAGGCGCGGTGG - Intergenic
905108451 1:35577548-35577570 CCGCTCCCGCCCAGGCTGGGAGG - Intronic
905872804 1:41414826-41414848 CTGTCCCTGCTGAGGCTGGGGGG + Intergenic
906143913 1:43549016-43549038 CCCACCCTGCATGGGCTTGGTGG + Intronic
906919398 1:50048120-50048142 CCGAGGCTGCGGAGGCTGGGTGG - Intronic
907332257 1:53678987-53679009 ATGACCCTCCACAGCCTGGGAGG + Intronic
910113738 1:83709958-83709980 ATTACCCTGCACAGGCTGGAAGG + Intergenic
912391121 1:109303756-109303778 CAGTCCCTGCACTGGCTGGCTGG + Intronic
913192666 1:116426596-116426618 CCTACCCAGCACCAGCTGGGAGG - Intergenic
916214208 1:162382112-162382134 CCCACACTGCCCAGGCTGGAGGG - Exonic
917943587 1:179947439-179947461 CCTACCCTGCCCAGGGTGGAAGG + Intergenic
920125787 1:203692848-203692870 CGGCCCCTGCCCAGGCTGGGTGG - Intronic
920257578 1:204665978-204666000 CTGACCCAGCACCTGCTGGGAGG + Intronic
922267061 1:223993120-223993142 CCGACCCTACCCAGGATGAGCGG - Intergenic
922696092 1:227731805-227731827 CAGGCCCTGCAAAGGCAGGGAGG + Exonic
1062912061 10:1217741-1217763 CCGACTCCTCACAGCCTGGGCGG - Intronic
1065277117 10:24096553-24096575 CAGACCCTGCAGAGCCTGGTAGG - Intronic
1067047119 10:42991093-42991115 CCAACCCTGCACAGGCCACGAGG - Intergenic
1070555585 10:77525390-77525412 CCAACCCTGCACTTTCTGGGTGG - Intronic
1071097645 10:81997321-81997343 GTGACCCTGCACAGGCACGGAGG - Intronic
1073307397 10:102514242-102514264 CCTACCCTCAACAGGCTGTGAGG - Intronic
1073475087 10:103747402-103747424 CCGAGGCTGCACAGGCTGAATGG - Intronic
1074960603 10:118441984-118442006 CCTACCCTCCAGAGGCTCGGGGG + Intergenic
1076451291 10:130558638-130558660 CCGGCTCTGCTCAGGCTGGCAGG - Intergenic
1076674055 10:132138720-132138742 CGGACCCTACACAGGCAGTGAGG - Intronic
1076734411 10:132452293-132452315 CCGACCCTGCAGTCTCTGGGTGG + Intergenic
1077339467 11:2019599-2019621 CCCACCCTGCTCTGGCTTGGTGG - Intergenic
1077376886 11:2209389-2209411 CCTTCCCAGCCCAGGCTGGGCGG + Intergenic
1077411376 11:2405461-2405483 CCCACTCTGCAGCGGCTGGGGGG - Intronic
1077539941 11:3141795-3141817 CAGTCCCTGCACTGGGTGGGAGG - Intronic
1077827424 11:5826319-5826341 CCTTCCCATCACAGGCTGGGAGG + Intronic
1078559129 11:12355339-12355361 CTGGCCCTGCCCACGCTGGGAGG - Intronic
1082283612 11:50298084-50298106 CCGACCCCGCCCAGGATGAGTGG + Intergenic
1083425364 11:62581622-62581644 CAGTCCCAGCACAGCCTGGGAGG - Exonic
1084144131 11:67255124-67255146 TCGACCCTGCACGGGCTCTGAGG + Exonic
1084857149 11:71996597-71996619 CCCACCCTGCTTAGGCAGGGAGG - Exonic
1088230600 11:107670123-107670145 CCTACCCTACAAAGGCTTGGAGG + Intergenic
1089457549 11:118634289-118634311 CCGACCCTGGGCAGGAGGGGAGG + Intronic
1090178557 11:124673589-124673611 CGGAGCCCGCACAGGCTGAGGGG + Intronic
1202822452 11_KI270721v1_random:74788-74810 CCCACCCTGCTCTGGCTTGGTGG - Intergenic
1091397436 12:162670-162692 CTGTCCCTGCACAGACTGGGAGG - Intronic
1091912429 12:4243116-4243138 CAGGCCCAGCACAGGCTGGCAGG + Intergenic
1092128802 12:6093976-6093998 CCAACCCTGACAAGGCTGGGAGG - Intronic
1092148962 12:6233906-6233928 TGGACCCTGCACAGGCTTGGGGG - Intronic
1092260763 12:6952225-6952247 CCCACCCTGAACAGCCAGGGAGG + Intronic
1096553508 12:52389592-52389614 TCAACCCTGATCAGGCTGGGTGG + Intergenic
1098394410 12:70003046-70003068 CACACGCTGCACAGGCTGCGAGG - Intergenic
1098425811 12:70365631-70365653 CTGACCCTGCTGAGGCCGGGAGG - Intergenic
1100309238 12:93378494-93378516 CCGCCCCTGCGCAGGCTGCGGGG + Intronic
1102060345 12:109926616-109926638 CTGAGCCTGCAGAGACTGGGGGG - Intronic
1102233117 12:111277226-111277248 CCCTCCCTGCGCAGGCTGGGAGG - Intronic
1102756777 12:115347978-115348000 CCTACCCTCCACCTGCTGGGGGG - Intergenic
1103738375 12:123075391-123075413 CCTGCCCAGCACAGCCTGGGTGG + Intronic
1105471992 13:20703490-20703512 CGGACCCTGCGCGGGCTGGCTGG + Intronic
1112078288 13:95936743-95936765 CAGTCTCTGCACAGGCAGGGTGG + Intronic
1112880736 13:104103613-104103635 CCGACACTGCCCAGGCTCTGTGG - Intergenic
1114547413 14:23513049-23513071 CCGGCACTGCCCAGCCTGGGCGG + Intergenic
1118410180 14:65470247-65470269 CCGAGCCTGCAAAGGCAAGGGGG + Intronic
1119793715 14:77376990-77377012 CCGACCCTGGGCGGGCTGTGGGG + Exonic
1120174219 14:81276427-81276449 CAGACCCTGCACAGGGTAGCTGG + Intronic
1121605515 14:95237313-95237335 CGGCACCTGCAGAGGCTGGGAGG + Intronic
1124439046 15:29674112-29674134 CCCAGCCTGCAGAGGATGGGGGG + Intergenic
1124604540 15:31160780-31160802 CCCACCCAGCACAGTTTGGGAGG + Intronic
1125422041 15:39513588-39513610 CCAACACTGCACAGGTTGGGTGG + Intergenic
1126531261 15:49713479-49713501 CCAACCCTGCACAGGCAGAATGG - Intergenic
1128426060 15:67543136-67543158 CCGAGCCTGCCCAGGCTGTCGGG - Exonic
1128676754 15:69615423-69615445 TCCACCCTGCTCTGGCTGGGAGG - Intergenic
1128812858 15:70585176-70585198 CCGTCCCTGCCCAGGCTGCCCGG + Intergenic
1128937351 15:71758027-71758049 CGGACCCTGCACGGGCAAGGTGG + Exonic
1128944791 15:71812848-71812870 CACACCCTGAACAGGCTGAGTGG + Intronic
1129144366 15:73633495-73633517 CCGCCCCTGCAGAGGCTGATTGG + Intronic
1131247955 15:90812238-90812260 CTACCCCTGCAAAGGCTGGGAGG - Intronic
1131984984 15:98033922-98033944 CCATCTCTCCACAGGCTGGGTGG + Intergenic
1132216483 15:100065877-100065899 CCACCCCTCAACAGGCTGGGGGG + Intronic
1132709916 16:1261841-1261863 CACACCGTGCTCAGGCTGGGAGG - Intergenic
1132727675 16:1345847-1345869 CTGACCCTGCCCAGGCTCAGGGG + Exonic
1132873517 16:2125831-2125853 CCCACCCTTCACAGCCTGTGTGG + Intronic
1132935233 16:2476649-2476671 CCGGCCCTGGCCAGGCTGTGGGG - Intronic
1133387072 16:5378387-5378409 CCGATCCTGGGCGGGCTGGGTGG - Intergenic
1134552607 16:15145009-15145031 CCCACCCTTCACAGCCTGGGTGG + Intergenic
1135097915 16:19579769-19579791 CAGACGCTGCTCAGGCTGGCTGG + Intronic
1135526118 16:23214971-23214993 CCGACCCTGCACAGGCTGGGAGG - Intronic
1136367595 16:29816115-29816137 GTGACCCTGCGCAGCCTGGGAGG + Exonic
1136615819 16:31397804-31397826 CCGACCCTGCACAGAGTCTGTGG + Exonic
1138143689 16:54589527-54589549 AGCACCCTGCACAGGTTGGGAGG - Intergenic
1139510273 16:67424160-67424182 CCGCCCCTGCACAGGCTCCCTGG + Intergenic
1141908392 16:87042376-87042398 GCCACCCTGTGCAGGCTGGGTGG - Intergenic
1142070857 16:88090782-88090804 CCGACCCCCCGCGGGCTGGGAGG - Intronic
1142410411 16:89913094-89913116 CCCACCCTCCACAGCCAGGGTGG + Intronic
1142470947 17:162973-162995 CACACCCGGCCCAGGCTGGGAGG + Intronic
1145766644 17:27462443-27462465 CTGAGGCTGCACAGCCTGGGTGG - Intronic
1145910657 17:28540284-28540306 CCGCCCCAGCAGAGGCTGGAAGG + Intronic
1147210704 17:38870951-38870973 CCCACCCGGCTCAGGCTGGACGG - Intronic
1147582615 17:41635811-41635833 CAGCACCTTCACAGGCTGGGCGG - Intergenic
1148052661 17:44776751-44776773 CCTAACCTGCACAAGCTGGACGG + Exonic
1148242644 17:46010638-46010660 CCCAGCCTGCGCAGGCTGTGTGG + Intronic
1150209303 17:63433554-63433576 CAGGCTCTGCTCAGGCTGGGAGG - Exonic
1150213355 17:63453662-63453684 GTGCCCCTGCACAGCCTGGGAGG + Intergenic
1151948330 17:77331509-77331531 GCCTCCCTGCCCAGGCTGGGCGG - Intronic
1151990322 17:77570409-77570431 CCTGCCCTGCAAAGGCTGTGTGG + Intergenic
1152740113 17:82015025-82015047 CGGGCCCTGCTCTGGCTGGGGGG + Intronic
1152825045 17:82459206-82459228 CCGCCCCTGCACCGGCTGCTCGG - Intronic
1160921697 19:1523827-1523849 CCGACCCTGCACACCCGGGCTGG - Intergenic
1161043472 19:2122168-2122190 TCTTCCCTGCACTGGCTGGGTGG - Intronic
1161259186 19:3326905-3326927 CTGGCTCTGCCCAGGCTGGGTGG - Intergenic
1161315683 19:3616177-3616199 CAGGCCCTACACAGGGTGGGAGG + Intronic
1161766337 19:6211005-6211027 CCGACCCTCCTCTGGCTGAGTGG + Intergenic
1162235951 19:9309720-9309742 CCGACCCGGGGCAGGCAGGGCGG + Intronic
1163149332 19:15401698-15401720 CCCACCCTGCCCTGGTTGGGAGG + Intronic
1164737057 19:30549260-30549282 CAGTCCCTGGACGGGCTGGGAGG - Exonic
1165403316 19:35615401-35615423 CCCACCCTCACCAGGCTGGGTGG + Intronic
1165894207 19:39131714-39131736 CCGACCCTTCCCAGGCTGGGAGG + Intronic
1166046932 19:40235342-40235364 CCGTCTCTGCACAGGCTTGGTGG - Exonic
1166283332 19:41809354-41809376 ACCAGCCTGGACAGGCTGGGTGG + Intronic
1166301159 19:41912927-41912949 CCGGCCCTGCAGAGGCCGGGAGG + Intronic
1166343444 19:42151591-42151613 CCGACCTTGCCCAAGCTGGAAGG - Intronic
1166888221 19:45973870-45973892 CAGACCCTGCTCGGGGTGGGGGG + Intergenic
1166898084 19:46036520-46036542 CCAAGCCTGCAAAGGCAGGGGGG - Intergenic
1166977571 19:46613717-46613739 CGGACCCTGCCCAGGCTTGCCGG + Intergenic
1167349675 19:48966655-48966677 ACCAACCTCCACAGGCTGGGTGG + Exonic
1167774544 19:51546053-51546075 CTGACCCTGCATAGGCTGCGGGG - Intergenic
1168274777 19:55271610-55271632 CCAGCCATGCAGAGGCTGGGAGG - Intronic
925450985 2:3968949-3968971 CAGAACGTGCTCAGGCTGGGGGG + Intergenic
930755306 2:54967172-54967194 CAGATCCTGCACAGACTTGGAGG - Intronic
935321725 2:101896060-101896082 CCCACACTGCACAGGCAGGCTGG - Intergenic
942222487 2:173784200-173784222 GCGGCCCTGTAGAGGCTGGGGGG + Intergenic
942834411 2:180276894-180276916 CTGACCCAGCACAGTCTCGGTGG - Intergenic
947713714 2:232329796-232329818 ACGAGCCTGCAGAGGGTGGGTGG - Exonic
947765131 2:232633225-232633247 GCGGCCCGGGACAGGCTGGGTGG - Exonic
948206743 2:236166708-236166730 CTGACGCTGCCGAGGCTGGGAGG - Intronic
948257061 2:236576260-236576282 CAGACCCCGCACAGGCTGAGAGG + Intronic
1168748675 20:266819-266841 CCGGCCCTGCAAAGACCGGGCGG + Intergenic
1168944289 20:1738735-1738757 CCCTCCCTGCAGAGGGTGGGGGG + Intergenic
1169245918 20:4024364-4024386 ACGAACCTCCACAGGCTGGGAGG + Intergenic
1170684799 20:18559530-18559552 CTGAACCAGCAAAGGCTGGGTGG - Intronic
1172102412 20:32493187-32493209 AGGACCCTCCACAGGCTGTGGGG + Intronic
1172646359 20:36472776-36472798 CAGACCCAGCCCAGGCTGAGGGG + Intronic
1172694848 20:36815494-36815516 CCGACTCTGCAGAGCCAGGGAGG - Exonic
1173869320 20:46331727-46331749 CACACCCTTCACTGGCTGGGAGG + Intergenic
1175010507 20:55729811-55729833 ACAACCCTGCAAAGACTGGGAGG - Intergenic
1176845518 21:13873664-13873686 CGGACGCTGCACAGTTTGGGGGG - Intergenic
1178409826 21:32353872-32353894 CCCACCCTGCACAGACTAGCCGG + Intronic
1178488584 21:33033767-33033789 CCGACCCCGCACAGGCTAACGGG + Intergenic
1181050542 22:20236392-20236414 CAGCCACTGCACAGGCTGGGAGG + Intergenic
1181349159 22:22243212-22243234 CCTCCTCTGCACAGGCTGGTGGG - Intergenic
1183465814 22:37979956-37979978 CCCTCCCTCCCCAGGCTGGGCGG + Intronic
1185223195 22:49639415-49639437 CCCACCCATGACAGGCTGGGAGG - Intronic
949395987 3:3615272-3615294 GTGACCTTGCACAGGCTGGGTGG + Intergenic
950053542 3:10009136-10009158 CCGACTCAGCCCAGCCTGGGCGG + Intronic
950114124 3:10439379-10439401 CCGCCCCTGCCCAGCATGGGTGG + Intronic
950305187 3:11911413-11911435 CCGACTCAGCCCAGCCTGGGTGG + Intergenic
950493912 3:13322401-13322423 CCAGGCCTGCACAGGCTGGCTGG + Intronic
950525520 3:13520681-13520703 CCTGCCCTGCACATGCTGTGTGG + Intergenic
953790369 3:45942796-45942818 CCCACCCTGCGTAGGCTGGCTGG - Intronic
953901825 3:46847844-46847866 CCAACCCGGCAGAGGCTGGGAGG + Intergenic
957107340 3:75907081-75907103 CGGTGGCTGCACAGGCTGGGAGG + Intronic
958675673 3:97265580-97265602 CCGAGCCTGCAGGGGCAGGGGGG + Intronic
960090205 3:113630939-113630961 CAGGCCCTGAACAGGTTGGGAGG + Intergenic
960556932 3:119040163-119040185 CAGACCCTGCACAGGATGGATGG + Intronic
965793180 3:172411262-172411284 CCGAGCCTGCAAGGGCAGGGGGG + Intergenic
967412548 3:189181174-189181196 CCCTCCCATCACAGGCTGGGAGG - Intronic
968000240 3:195200625-195200647 CCTGCCCTGCACAGGCTGTGAGG - Intronic
969241522 4:5901758-5901780 CCGAAGCAGCACAGGCTGGCAGG + Intronic
975766705 4:77676187-77676209 CCTAACCTGCACAGTCTGGGGGG - Intergenic
976826208 4:89263383-89263405 CCGCCAGTGCACAGGCTGGATGG - Intronic
976865290 4:89718229-89718251 CAGGCCCTGCACAGGATGGGCGG - Intergenic
985785791 5:1893457-1893479 CCATCCCTGCACAAGCTGGTGGG + Intergenic
990962465 5:61408979-61409001 CCGACCGCGCAGAGGCGGGGTGG + Intronic
1001932327 5:175682150-175682172 CCGAGCCGTCACAGGCTGTGAGG + Intronic
1003824556 6:9938781-9938803 CAGACTCTGCAAAGGCTGGCAGG - Intronic
1006500388 6:34455203-34455225 CCGACACTGAACAGCCTGGCTGG + Intergenic
1007074280 6:39056908-39056930 CAGTCCATGCACAGGCTGGGAGG - Intronic
1007178921 6:39914609-39914631 CCCAGCCTGCACAGCCTGGGTGG + Intronic
1007623059 6:43226472-43226494 CCCACCCTGCTCAGGGAGGGTGG + Intronic
1007631297 6:43274988-43275010 CCCTCCCTGCACAGGCTGTGGGG + Intronic
1008592149 6:53005185-53005207 CCGGCCATGCACTGGCTGGGCGG + Exonic
1015272273 6:131349363-131349385 CTGACCCTACCCAGCCTGGGTGG + Intergenic
1016693415 6:146965274-146965296 CCTTCCCATCACAGGCTGGGAGG + Intergenic
1017132357 6:151118582-151118604 CAGAAGCTGCACAGGCTGAGAGG - Intergenic
1017887445 6:158610752-158610774 ATGACGCAGCACAGGCTGGGAGG - Intronic
1020130116 7:5555029-5555051 CCGACTCTGCCCGGGCTGGGTGG + Intronic
1024068758 7:45768565-45768587 CCGACCCTGCCCAGGATGAACGG + Intergenic
1025150237 7:56541649-56541671 CAGACCCTGCAATGGCTGTGGGG - Intergenic
1025990639 7:66494092-66494114 CCGATCCTGCCCAGGATGAGCGG - Intergenic
1026038111 7:66844497-66844519 CCGAGCCTGCCCAGGATGAGCGG + Intergenic
1028814609 7:95130131-95130153 CCCTCCCATCACAGGCTGGGAGG + Intronic
1029372026 7:100156381-100156403 CAGAGCATGCACAGGCTGGTAGG - Exonic
1034863698 7:154622451-154622473 CAGACCCTGTACAGACTAGGAGG - Intronic
1035135475 7:156698738-156698760 CCCTCCCATCACAGGCTGGGAGG - Intronic
1035547264 8:492545-492567 CCCATCCTGGTCAGGCTGGGAGG - Exonic
1035777015 8:2196084-2196106 CCGGCCATGCAGAGGCTGGCGGG - Intergenic
1037567653 8:20130905-20130927 CCCATCCTCCAGAGGCTGGGAGG - Intergenic
1041044562 8:53878646-53878668 CAGACCCTCCACAGGCTGGTTGG - Intronic
1041725260 8:61012084-61012106 TGGACCCTGCACATCCTGGGAGG + Intergenic
1045240440 8:100396025-100396047 CCAACCGTGCTCAGCCTGGGTGG - Intronic
1045510806 8:102810730-102810752 CCGACCCCGCGCTGGGTGGGAGG + Intergenic
1047971178 8:130085979-130086001 CCTGCGCTGCCCAGGCTGGGAGG - Intronic
1048267683 8:133001845-133001867 CCACACCTGCACAGGCTGGCTGG - Intronic
1048834788 8:138509005-138509027 CTCACTCTGCACAGGCTGGAGGG + Intergenic
1049160894 8:141096811-141096833 GAGCCCCTGTACAGGCTGGGAGG - Intergenic
1049455148 8:142682854-142682876 ACGTCCCTGCAGAGGGTGGGAGG + Intergenic
1049642007 8:143720049-143720071 GCTCCCGTGCACAGGCTGGGTGG + Intronic
1049788648 8:144463004-144463026 CCGCCCCTGCAGAAGGTGGGCGG + Intronic
1050313944 9:4381948-4381970 CAGTCCCAGCACAGGCTGGGTGG + Intergenic
1052786179 9:32830695-32830717 CAGACCCTGCATGGCCTGGGTGG - Intergenic
1056817333 9:89811496-89811518 CCGTCACTGCAGAAGCTGGGTGG + Intergenic
1057198579 9:93128456-93128478 CAGACCCTGGGCAGCCTGGGAGG - Intronic
1057208767 9:93188224-93188246 TCTGCCCTCCACAGGCTGGGGGG + Intronic
1057332461 9:94128746-94128768 CCCACCCATCACAGGCTGGGAGG + Intergenic
1057623909 9:96660793-96660815 CAGAGCCTGCAATGGCTGGGTGG + Intergenic
1058486638 9:105448274-105448296 CCGGGCCGGCACAGGGTGGGCGG + Intronic
1059339287 9:113588362-113588384 CCGATCCAGCCCAGGCTGGCAGG - Intronic
1060885469 9:127149165-127149187 CCCACCCTGTCCAGGCTGGCCGG + Intronic
1061783322 9:133008328-133008350 CCGACCCTGCTCAGGGATGGGGG + Intergenic
1062109281 9:134773148-134773170 TTGACTCTGCACAAGCTGGGTGG + Intronic
1185477194 X:422296-422318 CCGGCCCTGCCCTGGCTGAGTGG + Intergenic
1185695754 X:2193172-2193194 CCAACCGTGCACAGGATGGACGG + Intergenic
1185736508 X:2500523-2500545 CCGACCCGGGACAGGCGGGGAGG + Intronic
1186323564 X:8455133-8455155 CCAAACCTGCACTGGGTGGGAGG - Intergenic
1188480354 X:30630745-30630767 ACCACCCTCCACAGGCTGGCCGG + Intergenic
1189196805 X:39160344-39160366 CCCACCCTGCCCATGCAGGGAGG - Intergenic
1189310166 X:40013090-40013112 CCGAGCCCGACCAGGCTGGGCGG - Intergenic
1190107114 X:47568900-47568922 CCACCCCTCCCCAGGCTGGGAGG - Intronic
1190344169 X:49322273-49322295 CCTTCCCTTCACAGGCTGCGAGG + Intronic
1190345264 X:49331818-49331840 CCTTCCCTTCACAGGCTGCGAGG + Intronic
1190346358 X:49341384-49341406 CCTTCCCTTCACAGGCTGCGAGG + Intronic
1190347609 X:49532413-49532435 CCTTCCCTTCACAGGCTGCGAGG + Intronic
1190348710 X:49541969-49541991 CCTTCCCTTCACAGGCTGCGAGG + Intronic
1190349810 X:49551525-49551547 CCTTCCCTTCACAGGCTGCGAGG + Intronic
1190350915 X:49561078-49561100 CCTTCCCTTCACAGGCTGCGAGG + Intronic
1190352016 X:49570636-49570658 CCTTCCCTTCACAGGCTGCGAGG + Intronic
1190353117 X:49580185-49580207 CCTTCCCTTCACAGGCTGCGAGG + Intronic
1190354218 X:49589732-49589754 CCTTCCCTTCACAGGCTGCGAGG + Intronic
1190355320 X:49599256-49599278 CCTTCCCTTCACAGGCTGCGAGG + Intronic
1190845066 X:54183414-54183436 CGGACCCGGGAGAGGCTGGGAGG + Intergenic
1194982294 X:100453113-100453135 CCCTCCCATCACAGGCTGGGAGG + Intergenic
1195454334 X:105051273-105051295 CCGAGCCTGCAGGGACTGGGGGG + Intronic
1197301751 X:124789281-124789303 CCCTCCCATCACAGGCTGGGAGG - Intronic
1197609631 X:128623617-128623639 CTGAGCCTGCAGAGGCAGGGTGG + Intergenic
1198466521 X:136909230-136909252 TAGGCCCTGCACAGGTTGGGGGG - Intergenic