ID: 1135526938

View in Genome Browser
Species Human (GRCh38)
Location 16:23220397-23220419
Sequence GACTTATCTGCAACTCTGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135526937_1135526938 6 Left 1135526937 16:23220368-23220390 CCTACGGTGATAATTTTAGGCAG No data
Right 1135526938 16:23220397-23220419 GACTTATCTGCAACTCTGAATGG No data
1135526936_1135526938 7 Left 1135526936 16:23220367-23220389 CCCTACGGTGATAATTTTAGGCA No data
Right 1135526938 16:23220397-23220419 GACTTATCTGCAACTCTGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135526938 Original CRISPR GACTTATCTGCAACTCTGAA TGG Intergenic
No off target data available for this crispr