ID: 1135530123

View in Genome Browser
Species Human (GRCh38)
Location 16:23245855-23245877
Sequence AGTAATTATGCAGTGGCATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135530123_1135530125 25 Left 1135530123 16:23245855-23245877 CCATATGCCACTGCATAATTACT No data
Right 1135530125 16:23245903-23245925 TTTCCATTTAAACACATTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135530123 Original CRISPR AGTAATTATGCAGTGGCATA TGG (reversed) Intergenic