ID: 1135530124

View in Genome Browser
Species Human (GRCh38)
Location 16:23245862-23245884
Sequence AATGTTAAGTAATTATGCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135530124_1135530127 24 Left 1135530124 16:23245862-23245884 CCACTGCATAATTACTTAACATT No data
Right 1135530127 16:23245909-23245931 TTTAAACACATTAATGGTAAAGG No data
1135530124_1135530128 25 Left 1135530124 16:23245862-23245884 CCACTGCATAATTACTTAACATT No data
Right 1135530128 16:23245910-23245932 TTAAACACATTAATGGTAAAGGG No data
1135530124_1135530125 18 Left 1135530124 16:23245862-23245884 CCACTGCATAATTACTTAACATT No data
Right 1135530125 16:23245903-23245925 TTTCCATTTAAACACATTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135530124 Original CRISPR AATGTTAAGTAATTATGCAG TGG (reversed) Intergenic