ID: 1135530722

View in Genome Browser
Species Human (GRCh38)
Location 16:23251070-23251092
Sequence TTCACCAGAACTGTGTCATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135530722_1135530727 21 Left 1135530722 16:23251070-23251092 CCATATGACACAGTTCTGGTGAA No data
Right 1135530727 16:23251114-23251136 CTGTGTGTGCAGGAGTTTTGGGG No data
1135530722_1135530723 11 Left 1135530722 16:23251070-23251092 CCATATGACACAGTTCTGGTGAA No data
Right 1135530723 16:23251104-23251126 CAGAAGCCTGCTGTGTGTGCAGG No data
1135530722_1135530726 20 Left 1135530722 16:23251070-23251092 CCATATGACACAGTTCTGGTGAA No data
Right 1135530726 16:23251113-23251135 GCTGTGTGTGCAGGAGTTTTGGG No data
1135530722_1135530725 19 Left 1135530722 16:23251070-23251092 CCATATGACACAGTTCTGGTGAA No data
Right 1135530725 16:23251112-23251134 TGCTGTGTGTGCAGGAGTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135530722 Original CRISPR TTCACCAGAACTGTGTCATA TGG (reversed) Intergenic
No off target data available for this crispr