ID: 1135534133

View in Genome Browser
Species Human (GRCh38)
Location 16:23279758-23279780
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135534132_1135534133 -2 Left 1135534132 16:23279737-23279759 CCTTCTACGTTCAGATGGGTTGC No data
Right 1135534133 16:23279758-23279780 GCAGCTCTTTAAACCCAGCCAGG No data
1135534129_1135534133 23 Left 1135534129 16:23279712-23279734 CCAAGATTGTGGAGTGAAATTCG No data
Right 1135534133 16:23279758-23279780 GCAGCTCTTTAAACCCAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr