ID: 1135539300

View in Genome Browser
Species Human (GRCh38)
Location 16:23317639-23317661
Sequence TCCCAAAGGGTTCCCCAGAG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135539291_1135539300 30 Left 1135539291 16:23317586-23317608 CCTTTTCCAGGCTGCACGGAGGA No data
Right 1135539300 16:23317639-23317661 TCCCAAAGGGTTCCCCAGAGCGG No data
1135539295_1135539300 -9 Left 1135539295 16:23317625-23317647 CCTTCCTGCTCCTGTCCCAAAGG No data
Right 1135539300 16:23317639-23317661 TCCCAAAGGGTTCCCCAGAGCGG No data
1135539292_1135539300 24 Left 1135539292 16:23317592-23317614 CCAGGCTGCACGGAGGAGCTCTC 0: 1
1: 0
2: 0
3: 12
4: 193
Right 1135539300 16:23317639-23317661 TCCCAAAGGGTTCCCCAGAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135539300 Original CRISPR TCCCAAAGGGTTCCCCAGAG CGG Intronic
No off target data available for this crispr