ID: 1135546809

View in Genome Browser
Species Human (GRCh38)
Location 16:23371959-23371981
Sequence AGAGCTGGCCCCAGCAAGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 210}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135546802_1135546809 12 Left 1135546802 16:23371924-23371946 CCGGGTTTATGGGGCCAAGGCCT 0: 1
1: 0
2: 0
3: 9
4: 101
Right 1135546809 16:23371959-23371981 AGAGCTGGCCCCAGCAAGTCTGG 0: 1
1: 0
2: 0
3: 20
4: 210
1135546792_1135546809 27 Left 1135546792 16:23371909-23371931 CCCCGGGGCCCCTGTCCGGGTTT 0: 1
1: 0
2: 0
3: 8
4: 87
Right 1135546809 16:23371959-23371981 AGAGCTGGCCCCAGCAAGTCTGG 0: 1
1: 0
2: 0
3: 20
4: 210
1135546806_1135546809 -8 Left 1135546806 16:23371944-23371966 CCTCAGTACTCCGGGAGAGCTGG 0: 1
1: 0
2: 1
3: 8
4: 92
Right 1135546809 16:23371959-23371981 AGAGCTGGCCCCAGCAAGTCTGG 0: 1
1: 0
2: 0
3: 20
4: 210
1135546793_1135546809 26 Left 1135546793 16:23371910-23371932 CCCGGGGCCCCTGTCCGGGTTTA 0: 1
1: 0
2: 1
3: 4
4: 81
Right 1135546809 16:23371959-23371981 AGAGCTGGCCCCAGCAAGTCTGG 0: 1
1: 0
2: 0
3: 20
4: 210
1135546800_1135546809 17 Left 1135546800 16:23371919-23371941 CCTGTCCGGGTTTATGGGGCCAA 0: 1
1: 0
2: 0
3: 3
4: 39
Right 1135546809 16:23371959-23371981 AGAGCTGGCCCCAGCAAGTCTGG 0: 1
1: 0
2: 0
3: 20
4: 210
1135546799_1135546809 18 Left 1135546799 16:23371918-23371940 CCCTGTCCGGGTTTATGGGGCCA 0: 1
1: 0
2: 0
3: 4
4: 44
Right 1135546809 16:23371959-23371981 AGAGCTGGCCCCAGCAAGTCTGG 0: 1
1: 0
2: 0
3: 20
4: 210
1135546798_1135546809 19 Left 1135546798 16:23371917-23371939 CCCCTGTCCGGGTTTATGGGGCC 0: 1
1: 0
2: 0
3: 2
4: 48
Right 1135546809 16:23371959-23371981 AGAGCTGGCCCCAGCAAGTCTGG 0: 1
1: 0
2: 0
3: 20
4: 210
1135546794_1135546809 25 Left 1135546794 16:23371911-23371933 CCGGGGCCCCTGTCCGGGTTTAT 0: 1
1: 0
2: 1
3: 0
4: 79
Right 1135546809 16:23371959-23371981 AGAGCTGGCCCCAGCAAGTCTGG 0: 1
1: 0
2: 0
3: 20
4: 210
1135546805_1135546809 -2 Left 1135546805 16:23371938-23371960 CCAAGGCCTCAGTACTCCGGGAG 0: 1
1: 0
2: 0
3: 8
4: 118
Right 1135546809 16:23371959-23371981 AGAGCTGGCCCCAGCAAGTCTGG 0: 1
1: 0
2: 0
3: 20
4: 210

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135546809 Original CRISPR AGAGCTGGCCCCAGCAAGTC TGG Intronic