ID: 1135551669

View in Genome Browser
Species Human (GRCh38)
Location 16:23403246-23403268
Sequence GTTTTTGAGGGGGCTTTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135551669_1135551676 -2 Left 1135551669 16:23403246-23403268 CCCTCCAAAGCCCCCTCAAAAAC No data
Right 1135551676 16:23403267-23403289 ACACAAGTTCAATTCTGATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135551669 Original CRISPR GTTTTTGAGGGGGCTTTGGA GGG (reversed) Intronic
No off target data available for this crispr