ID: 1135551676

View in Genome Browser
Species Human (GRCh38)
Location 16:23403267-23403289
Sequence ACACAAGTTCAATTCTGATA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135551671_1135551676 -6 Left 1135551671 16:23403250-23403272 CCAAAGCCCCCTCAAAAACACAA 0: 1
1: 0
2: 0
3: 34
4: 365
Right 1135551676 16:23403267-23403289 ACACAAGTTCAATTCTGATAAGG No data
1135551669_1135551676 -2 Left 1135551669 16:23403246-23403268 CCCTCCAAAGCCCCCTCAAAAAC No data
Right 1135551676 16:23403267-23403289 ACACAAGTTCAATTCTGATAAGG No data
1135551670_1135551676 -3 Left 1135551670 16:23403247-23403269 CCTCCAAAGCCCCCTCAAAAACA No data
Right 1135551676 16:23403267-23403289 ACACAAGTTCAATTCTGATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135551676 Original CRISPR ACACAAGTTCAATTCTGATA AGG Intronic
No off target data available for this crispr