ID: 1135554503

View in Genome Browser
Species Human (GRCh38)
Location 16:23424812-23424834
Sequence GCAGGAGCTCACCAGGCTGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 402
Summary {0: 1, 1: 1, 2: 4, 3: 32, 4: 364}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135554503_1135554513 14 Left 1135554503 16:23424812-23424834 CCAGCAGCCTGGTGAGCTCCTGC 0: 1
1: 1
2: 4
3: 32
4: 364
Right 1135554513 16:23424849-23424871 CTCCACGCCGTTGCTGAGGCAGG 0: 1
1: 0
2: 0
3: 10
4: 174
1135554503_1135554519 27 Left 1135554503 16:23424812-23424834 CCAGCAGCCTGGTGAGCTCCTGC 0: 1
1: 1
2: 4
3: 32
4: 364
Right 1135554519 16:23424862-23424884 CTGAGGCAGGAGGGCAGCGAGGG 0: 1
1: 0
2: 5
3: 76
4: 709
1135554503_1135554515 17 Left 1135554503 16:23424812-23424834 CCAGCAGCCTGGTGAGCTCCTGC 0: 1
1: 1
2: 4
3: 32
4: 364
Right 1135554515 16:23424852-23424874 CACGCCGTTGCTGAGGCAGGAGG 0: 1
1: 0
2: 0
3: 17
4: 238
1135554503_1135554511 10 Left 1135554503 16:23424812-23424834 CCAGCAGCCTGGTGAGCTCCTGC 0: 1
1: 1
2: 4
3: 32
4: 364
Right 1135554511 16:23424845-23424867 CCCTCTCCACGCCGTTGCTGAGG 0: 1
1: 0
2: 0
3: 5
4: 116
1135554503_1135554518 26 Left 1135554503 16:23424812-23424834 CCAGCAGCCTGGTGAGCTCCTGC 0: 1
1: 1
2: 4
3: 32
4: 364
Right 1135554518 16:23424861-23424883 GCTGAGGCAGGAGGGCAGCGAGG 0: 1
1: 0
2: 8
3: 184
4: 2072
1135554503_1135554516 18 Left 1135554503 16:23424812-23424834 CCAGCAGCCTGGTGAGCTCCTGC 0: 1
1: 1
2: 4
3: 32
4: 364
Right 1135554516 16:23424853-23424875 ACGCCGTTGCTGAGGCAGGAGGG 0: 1
1: 0
2: 0
3: 15
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135554503 Original CRISPR GCAGGAGCTCACCAGGCTGC TGG (reversed) Exonic