ID: 1135554506

View in Genome Browser
Species Human (GRCh38)
Location 16:23424819-23424841
Sequence GGCCCGAGCAGGAGCTCACC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 3, 3: 18, 4: 170}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135554506_1135554519 20 Left 1135554506 16:23424819-23424841 CCTGGTGAGCTCCTGCTCGGGCC 0: 1
1: 0
2: 3
3: 18
4: 170
Right 1135554519 16:23424862-23424884 CTGAGGCAGGAGGGCAGCGAGGG 0: 1
1: 0
2: 5
3: 76
4: 709
1135554506_1135554511 3 Left 1135554506 16:23424819-23424841 CCTGGTGAGCTCCTGCTCGGGCC 0: 1
1: 0
2: 3
3: 18
4: 170
Right 1135554511 16:23424845-23424867 CCCTCTCCACGCCGTTGCTGAGG 0: 1
1: 0
2: 0
3: 5
4: 116
1135554506_1135554513 7 Left 1135554506 16:23424819-23424841 CCTGGTGAGCTCCTGCTCGGGCC 0: 1
1: 0
2: 3
3: 18
4: 170
Right 1135554513 16:23424849-23424871 CTCCACGCCGTTGCTGAGGCAGG 0: 1
1: 0
2: 0
3: 10
4: 174
1135554506_1135554516 11 Left 1135554506 16:23424819-23424841 CCTGGTGAGCTCCTGCTCGGGCC 0: 1
1: 0
2: 3
3: 18
4: 170
Right 1135554516 16:23424853-23424875 ACGCCGTTGCTGAGGCAGGAGGG 0: 1
1: 0
2: 0
3: 15
4: 173
1135554506_1135554518 19 Left 1135554506 16:23424819-23424841 CCTGGTGAGCTCCTGCTCGGGCC 0: 1
1: 0
2: 3
3: 18
4: 170
Right 1135554518 16:23424861-23424883 GCTGAGGCAGGAGGGCAGCGAGG 0: 1
1: 0
2: 8
3: 184
4: 2072
1135554506_1135554520 27 Left 1135554506 16:23424819-23424841 CCTGGTGAGCTCCTGCTCGGGCC 0: 1
1: 0
2: 3
3: 18
4: 170
Right 1135554520 16:23424869-23424891 AGGAGGGCAGCGAGGGCATGAGG 0: 1
1: 1
2: 12
3: 55
4: 541
1135554506_1135554515 10 Left 1135554506 16:23424819-23424841 CCTGGTGAGCTCCTGCTCGGGCC 0: 1
1: 0
2: 3
3: 18
4: 170
Right 1135554515 16:23424852-23424874 CACGCCGTTGCTGAGGCAGGAGG 0: 1
1: 0
2: 0
3: 17
4: 238
1135554506_1135554521 28 Left 1135554506 16:23424819-23424841 CCTGGTGAGCTCCTGCTCGGGCC 0: 1
1: 0
2: 3
3: 18
4: 170
Right 1135554521 16:23424870-23424892 GGAGGGCAGCGAGGGCATGAGGG 0: 1
1: 0
2: 5
3: 63
4: 611

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135554506 Original CRISPR GGCCCGAGCAGGAGCTCACC AGG (reversed) Exonic