ID: 1135554507

View in Genome Browser
Species Human (GRCh38)
Location 16:23424830-23424852
Sequence GGAGAGGGCAGGGCCCGAGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 971
Summary {0: 1, 1: 0, 2: 6, 3: 93, 4: 871}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135554507_1135554519 9 Left 1135554507 16:23424830-23424852 CCTGCTCGGGCCCTGCCCTCTCC 0: 1
1: 0
2: 6
3: 93
4: 871
Right 1135554519 16:23424862-23424884 CTGAGGCAGGAGGGCAGCGAGGG 0: 1
1: 0
2: 5
3: 76
4: 709
1135554507_1135554516 0 Left 1135554507 16:23424830-23424852 CCTGCTCGGGCCCTGCCCTCTCC 0: 1
1: 0
2: 6
3: 93
4: 871
Right 1135554516 16:23424853-23424875 ACGCCGTTGCTGAGGCAGGAGGG 0: 1
1: 0
2: 0
3: 15
4: 173
1135554507_1135554518 8 Left 1135554507 16:23424830-23424852 CCTGCTCGGGCCCTGCCCTCTCC 0: 1
1: 0
2: 6
3: 93
4: 871
Right 1135554518 16:23424861-23424883 GCTGAGGCAGGAGGGCAGCGAGG 0: 1
1: 0
2: 8
3: 184
4: 2072
1135554507_1135554513 -4 Left 1135554507 16:23424830-23424852 CCTGCTCGGGCCCTGCCCTCTCC 0: 1
1: 0
2: 6
3: 93
4: 871
Right 1135554513 16:23424849-23424871 CTCCACGCCGTTGCTGAGGCAGG 0: 1
1: 0
2: 0
3: 10
4: 174
1135554507_1135554522 25 Left 1135554507 16:23424830-23424852 CCTGCTCGGGCCCTGCCCTCTCC 0: 1
1: 0
2: 6
3: 93
4: 871
Right 1135554522 16:23424878-23424900 GCGAGGGCATGAGGGCCCCCAGG 0: 1
1: 0
2: 0
3: 15
4: 219
1135554507_1135554511 -8 Left 1135554507 16:23424830-23424852 CCTGCTCGGGCCCTGCCCTCTCC 0: 1
1: 0
2: 6
3: 93
4: 871
Right 1135554511 16:23424845-23424867 CCCTCTCCACGCCGTTGCTGAGG 0: 1
1: 0
2: 0
3: 5
4: 116
1135554507_1135554523 26 Left 1135554507 16:23424830-23424852 CCTGCTCGGGCCCTGCCCTCTCC 0: 1
1: 0
2: 6
3: 93
4: 871
Right 1135554523 16:23424879-23424901 CGAGGGCATGAGGGCCCCCAGGG 0: 1
1: 0
2: 1
3: 22
4: 150
1135554507_1135554520 16 Left 1135554507 16:23424830-23424852 CCTGCTCGGGCCCTGCCCTCTCC 0: 1
1: 0
2: 6
3: 93
4: 871
Right 1135554520 16:23424869-23424891 AGGAGGGCAGCGAGGGCATGAGG 0: 1
1: 1
2: 12
3: 55
4: 541
1135554507_1135554521 17 Left 1135554507 16:23424830-23424852 CCTGCTCGGGCCCTGCCCTCTCC 0: 1
1: 0
2: 6
3: 93
4: 871
Right 1135554521 16:23424870-23424892 GGAGGGCAGCGAGGGCATGAGGG 0: 1
1: 0
2: 5
3: 63
4: 611
1135554507_1135554515 -1 Left 1135554507 16:23424830-23424852 CCTGCTCGGGCCCTGCCCTCTCC 0: 1
1: 0
2: 6
3: 93
4: 871
Right 1135554515 16:23424852-23424874 CACGCCGTTGCTGAGGCAGGAGG 0: 1
1: 0
2: 0
3: 17
4: 238

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135554507 Original CRISPR GGAGAGGGCAGGGCCCGAGC AGG (reversed) Exonic