ID: 1135554511

View in Genome Browser
Species Human (GRCh38)
Location 16:23424845-23424867
Sequence CCCTCTCCACGCCGTTGCTG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 116}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135554506_1135554511 3 Left 1135554506 16:23424819-23424841 CCTGGTGAGCTCCTGCTCGGGCC 0: 1
1: 0
2: 3
3: 18
4: 170
Right 1135554511 16:23424845-23424867 CCCTCTCCACGCCGTTGCTGAGG 0: 1
1: 0
2: 0
3: 5
4: 116
1135554507_1135554511 -8 Left 1135554507 16:23424830-23424852 CCTGCTCGGGCCCTGCCCTCTCC 0: 1
1: 0
2: 6
3: 93
4: 871
Right 1135554511 16:23424845-23424867 CCCTCTCCACGCCGTTGCTGAGG 0: 1
1: 0
2: 0
3: 5
4: 116
1135554503_1135554511 10 Left 1135554503 16:23424812-23424834 CCAGCAGCCTGGTGAGCTCCTGC 0: 1
1: 1
2: 4
3: 32
4: 364
Right 1135554511 16:23424845-23424867 CCCTCTCCACGCCGTTGCTGAGG 0: 1
1: 0
2: 0
3: 5
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135554511 Original CRISPR CCCTCTCCACGCCGTTGCTG AGG Exonic
901024915 1:6274085-6274107 CCCTCTGCACACCGTGCCTGGGG + Intronic
901183267 1:7356252-7356274 CCCTCTGCAGGCAGTTCCTGGGG + Intronic
901332861 1:8424014-8424036 CCCTCTCCCCACGCTTGCTGCGG - Intronic
905155202 1:35972185-35972207 CCCTGTCCATGCCGTTGATGTGG + Exonic
908669898 1:66534259-66534281 TCCTCACCACGCCGCTGCTGAGG - Intronic
911258183 1:95656525-95656547 GCCTCTCCACACCGTTGCACTGG - Intergenic
914050557 1:144126812-144126834 CCCTCTCCACGTGGGAGCTGGGG - Intergenic
914128625 1:144838633-144838655 CCCTCTCCACGTGGGAGCTGGGG + Intergenic
914171888 1:145233161-145233183 CCCTCTCCATACAGTGGCTGTGG + Intergenic
917980591 1:180266620-180266642 CCCTCTCCAGGCCTTTGTTTGGG + Intronic
918146062 1:181756973-181756995 ACATCTCCATGCGGTTGCTGCGG - Exonic
922364565 1:224851818-224851840 TCCTCTCCACTCCTTTGCTTTGG - Intergenic
923730783 1:236547663-236547685 GCCCCTCCTCGCCGATGCTGGGG - Intronic
1069768470 10:70881848-70881870 CCCTTTCCTGGCCTTTGCTGGGG + Intergenic
1070727620 10:78803069-78803091 CCCTCCCCACGCGCTTCCTGCGG - Intergenic
1070777806 10:79120016-79120038 CCCTCTCCACGCCACTGTTATGG - Intronic
1075761022 10:124856768-124856790 CCCTCTCCCCTCCCTTCCTGAGG + Intergenic
1077301622 11:1849911-1849933 CCTTCTCCACGACGGTGATGTGG + Intergenic
1079095416 11:17506804-17506826 CCGTCTCCACGCTGATGGTGTGG + Intronic
1083995442 11:66269300-66269322 CCCTCTCCTCGCTTTTGCTCAGG + Intronic
1084241882 11:67826885-67826907 GCCTCTCCATGCTCTTGCTGTGG - Intergenic
1084979948 11:72823667-72823689 CCCTCTCCTGGGCATTGCTGAGG + Intronic
1090393815 11:126406329-126406351 CCCTCTCCTGGCCCTGGCTGAGG - Intronic
1092733465 12:11556861-11556883 CCCTCTCCAGGCCGGTGCCAAGG - Intergenic
1092881877 12:12893020-12893042 ACCTCTCCACGCCCTTGGAGAGG - Intronic
1093266988 12:17015636-17015658 CACTCTCCAGGCTGGTGCTGGGG + Intergenic
1094838928 12:34334916-34334938 CCCCCACCAAGCCGTTCCTGCGG + Intergenic
1100839078 12:98593861-98593883 CCGTCTCCACGCCCTTGAAGAGG - Intronic
1101739560 12:107490363-107490385 CCCTCTCCAATCCATTGCAGGGG - Intronic
1101965972 12:109282096-109282118 CCCTCTGCACACGGTTGTTGTGG + Intronic
1102494561 12:113310556-113310578 CTCTCTCCAGCCTGTTGCTGTGG + Intronic
1103133388 12:118487672-118487694 CCCTCTCCAGGAAGTAGCTGAGG - Intergenic
1104653621 12:130556786-130556808 TCCTCTCCACACTGTTCCTGGGG - Intronic
1104797539 12:131529887-131529909 CCCCCACCACGCCCTTTCTGTGG + Intergenic
1104899223 12:132179372-132179394 GCTGCTCCACGCCCTTGCTGTGG + Intergenic
1113038205 13:106074524-106074546 CCACCTCCACGCAGTGGCTGGGG + Intergenic
1113898665 13:113783631-113783653 CCCTCTCCAGGAAGTAGCTGGGG - Intronic
1119770859 14:77219917-77219939 CCCTCCCCACTCCCTGGCTGAGG - Intronic
1123013781 14:105363628-105363650 CTCTCTCCACACCGTCACTGAGG + Intronic
1123427949 15:20188092-20188114 CCCTCTCCTCCCCACTGCTGAGG + Intergenic
1124597252 15:31101660-31101682 CCCTCTCCATTCCACTGCTGTGG - Intronic
1126370930 15:47946333-47946355 ACCTCTCCAAGCCCTTGCAGAGG + Intergenic
1131466958 15:92663396-92663418 TCCCCTCCACTCCTTTGCTGTGG - Intronic
1132055536 15:98648446-98648468 CCCTCGGCGCGCCGCTGCTGCGG + Intergenic
1135554511 16:23424845-23424867 CCCTCTCCACGCCGTTGCTGAGG + Exonic
1136454554 16:30372868-30372890 CGCTCTCCAGGCCTTTGCTCAGG + Intronic
1139334809 16:66224297-66224319 CCCTTCCCACCCCTTTGCTGGGG + Intergenic
1142829948 17:2541420-2541442 TCCTCACCACTCTGTTGCTGAGG + Intergenic
1143393935 17:6576922-6576944 CCCTCTGCCCGCCGGAGCTGGGG - Intergenic
1149182547 17:53956645-53956667 CCCACTCCACTCCTTTACTGAGG - Intergenic
1151942888 17:77303861-77303883 ACCTCGCCAGGCCCTTGCTGTGG - Intronic
1152397086 17:80040076-80040098 TCCTCTCCAGGCAGTTCCTGAGG - Exonic
1154297405 18:13162749-13162771 CCCTCACCAGGCTGCTGCTGTGG - Intergenic
1157700091 18:49756834-49756856 CCCTCTCCACCACATTGGTGAGG - Intergenic
1161702367 19:5802514-5802536 CCCCCTCCCCGCCGCGGCTGGGG - Intergenic
1164713619 19:30376242-30376264 CCCTATACACGCCTTTGTTGAGG + Intronic
1164806981 19:31124564-31124586 CCCTACCCAGGCCTTTGCTGTGG - Intergenic
1202689964 1_KI270712v1_random:79450-79472 CCCTCTCCACGTGGGAGCTGGGG - Intergenic
925589409 2:5494387-5494409 TGCTCTCCAAGCCGCTGCTGAGG - Intergenic
926202678 2:10812841-10812863 CGCTCGCCAAGCCGTGGCTGCGG + Intronic
927422553 2:22948488-22948510 CCCTCTGCACGCCTCTGCTTTGG - Intergenic
933956452 2:87376573-87376595 CCCTCTCCACGTGGGAGCTGGGG + Intergenic
934240600 2:90268599-90268621 CCCTCTCCACGTGGGAGCTGGGG + Intergenic
934272592 2:91548160-91548182 CCCTCTCCACGTGGGAGCTGGGG - Intergenic
940198000 2:151117362-151117384 ACCTCTCCATGCTGTTGCTTTGG - Intergenic
948019278 2:234716626-234716648 CCCTCTGGACGCTGTTGCTTTGG + Intergenic
948097758 2:235350031-235350053 CCATCTCCCCGCTGTGGCTGTGG - Intergenic
1170658475 20:18313871-18313893 CTCTCCCCACGCCAGTGCTGAGG - Intronic
1171106463 20:22438248-22438270 CCCTCTCCATGCACTTGTTGGGG - Intergenic
1171215017 20:23345986-23346008 CCTTCTCCAAGTCCTTGCTGTGG - Intergenic
1172699291 20:36843102-36843124 CCCTCACCACACCCTCGCTGGGG + Intronic
1175191744 20:57216353-57216375 CCCTCTCCAGGTGGTTCCTGGGG - Intronic
1175751397 20:61500410-61500432 CCCTCTCCACGCCCGTGATGTGG - Intronic
1175807429 20:61837727-61837749 CCCTCACAACGGCGTCGCTGGGG - Intronic
1176213007 20:63934421-63934443 CCCTTTGGACGCCGCTGCTGGGG + Exonic
1179410865 21:41162170-41162192 CCCTCACCATGCCATGGCTGTGG + Intergenic
1180614679 22:17119802-17119824 CCCTCGCCTCGCCGGTGCTCTGG - Exonic
1181103272 22:20555621-20555643 TCCTCTCCACACGGCTGCTGTGG + Intronic
1181473419 22:23154406-23154428 CCATCTCCAGGGCTTTGCTGGGG - Intronic
1181943783 22:26499295-26499317 CCATCTCCAGGACCTTGCTGAGG + Exonic
1183315870 22:37136519-37136541 CCCTCACTACCCAGTTGCTGGGG + Intronic
1183407559 22:37637986-37638008 CCCTCACCAGGCCGGAGCTGGGG + Intronic
1184781218 22:46650600-46650622 CCTTCTCCTCGCAGATGCTGGGG + Intronic
1184916039 22:47569683-47569705 CTCACTCCACGCAGGTGCTGAGG - Intergenic
1185217028 22:49607244-49607266 ACCTCCCCACGCTGTTGCTTTGG - Intronic
950096295 3:10332742-10332764 CTCTTGCCACGCCCTTGCTGTGG + Intronic
952311252 3:32192470-32192492 CCCTCTCCACTCCCAGGCTGTGG + Intergenic
955410674 3:58653532-58653554 CCCTCTCCCTGCAATTGCTGGGG + Intronic
965701218 3:171460566-171460588 CCCCCTCCACGCTGGTGCAGAGG - Intergenic
968733250 4:2281647-2281669 CCCTCTCAACGCTGTTGCAGTGG + Intronic
969591023 4:8122030-8122052 CTCTCTCCAGGCAGCTGCTGTGG + Intronic
971266890 4:25103598-25103620 CCCTTTCCTGGCCCTTGCTGCGG - Intergenic
983891912 4:173038314-173038336 CCCTCTCCCAGCCGCTGCTGTGG - Intronic
983893695 4:173058623-173058645 CCCTCACCAGGCAGTTTCTGTGG - Intergenic
986311101 5:6551724-6551746 CCTTCTCCACGCCTTTGCCCAGG + Intergenic
990307255 5:54505519-54505541 CCCTCTCCAAGTTGTTTCTGGGG + Intergenic
992279451 5:75158878-75158900 CCCTCTCAAAGCAGTTCCTGTGG - Intronic
1002051203 5:176572598-176572620 CCCACTCCTCCCCCTTGCTGCGG - Intronic
1002344031 5:178535789-178535811 CCCTCTCCACGATGGGGCTGGGG - Intronic
1006129721 6:31862065-31862087 CACTCTTCTCGCCTTTGCTGAGG - Exonic
1012191728 6:96287896-96287918 CACACTCCAGGCTGTTGCTGGGG - Intergenic
1012595755 6:101036675-101036697 CACTCTGCACTCTGTTGCTGAGG - Intergenic
1018618589 6:165709647-165709669 CACTCTCCACCCCAATGCTGCGG + Intronic
1018618600 6:165709684-165709706 CACTCTCCACCCCCATGCTGCGG + Intronic
1019934027 7:4242655-4242677 CCTCCTCCACCCCGATGCTGGGG - Intronic
1024160001 7:46664216-46664238 CCTCCTCCAGGCCTTTGCTGTGG - Intergenic
1024731482 7:52258246-52258268 CCCACTCCATGCCTTTGCTAAGG + Intergenic
1028583707 7:92432744-92432766 CCCTCACCACTCCTTTCCTGTGG - Intergenic
1029390485 7:100271396-100271418 CCCTCCCCACGCCGTGGCGACGG + Intronic
1030344098 7:108413817-108413839 CCCTCTCCACACTGTTCCTCTGG + Intronic
1032084879 7:128878714-128878736 GCCTCTCCACACAGGTGCTGTGG - Exonic
1034553316 7:151834705-151834727 CTCCCTCCACTCCGTTCCTGGGG - Intronic
1035344106 7:158186979-158187001 CCCTGTCCACTCTGTTACTGAGG - Intronic
1037947649 8:22999387-22999409 CCCTCCCCGCGGCGTCGCTGCGG + Intronic
1040010324 8:42656368-42656390 CCCTCTCCATGCCCTGGCTCTGG + Intergenic
1045409950 8:101906801-101906823 GCCTCTCCATGCCCTTGCTCTGG - Intronic
1048989669 8:139753853-139753875 CCCTCTCCTCGCCTGTGTTGTGG + Intronic
1057388630 9:94625386-94625408 CCCTGTCCATGCAGGTGCTGAGG - Intronic
1062293981 9:135813961-135813983 CCCTCTTCACCCAGTGGCTGTGG + Intronic
1062495726 9:136830681-136830703 CTCCCTCCAGGCCGTTCCTGTGG - Intronic
1190875716 X:54458862-54458884 CCCTCTCCAGGCAGATGCTTTGG + Intronic
1201684167 Y:16682646-16682668 CCCTCTCCAAGCATTTTCTGTGG + Intergenic