ID: 1135554511

View in Genome Browser
Species Human (GRCh38)
Location 16:23424845-23424867
Sequence CCCTCTCCACGCCGTTGCTG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 116}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135554503_1135554511 10 Left 1135554503 16:23424812-23424834 CCAGCAGCCTGGTGAGCTCCTGC 0: 1
1: 1
2: 4
3: 32
4: 364
Right 1135554511 16:23424845-23424867 CCCTCTCCACGCCGTTGCTGAGG 0: 1
1: 0
2: 0
3: 5
4: 116
1135554506_1135554511 3 Left 1135554506 16:23424819-23424841 CCTGGTGAGCTCCTGCTCGGGCC 0: 1
1: 0
2: 3
3: 18
4: 170
Right 1135554511 16:23424845-23424867 CCCTCTCCACGCCGTTGCTGAGG 0: 1
1: 0
2: 0
3: 5
4: 116
1135554507_1135554511 -8 Left 1135554507 16:23424830-23424852 CCTGCTCGGGCCCTGCCCTCTCC 0: 1
1: 0
2: 6
3: 93
4: 871
Right 1135554511 16:23424845-23424867 CCCTCTCCACGCCGTTGCTGAGG 0: 1
1: 0
2: 0
3: 5
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135554511 Original CRISPR CCCTCTCCACGCCGTTGCTG AGG Exonic