ID: 1135554511 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 16:23424845-23424867 |
Sequence | CCCTCTCCACGCCGTTGCTG AGG |
Strand | + |
Crispr in exon? | Yes |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 122 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 5, 4: 116} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1135554507_1135554511 | -8 | Left | 1135554507 | 16:23424830-23424852 | CCTGCTCGGGCCCTGCCCTCTCC | 0: 1 1: 0 2: 6 3: 93 4: 871 |
||
Right | 1135554511 | 16:23424845-23424867 | CCCTCTCCACGCCGTTGCTGAGG | 0: 1 1: 0 2: 0 3: 5 4: 116 |
||||
1135554506_1135554511 | 3 | Left | 1135554506 | 16:23424819-23424841 | CCTGGTGAGCTCCTGCTCGGGCC | 0: 1 1: 0 2: 3 3: 18 4: 170 |
||
Right | 1135554511 | 16:23424845-23424867 | CCCTCTCCACGCCGTTGCTGAGG | 0: 1 1: 0 2: 0 3: 5 4: 116 |
||||
1135554503_1135554511 | 10 | Left | 1135554503 | 16:23424812-23424834 | CCAGCAGCCTGGTGAGCTCCTGC | 0: 1 1: 1 2: 4 3: 32 4: 364 |
||
Right | 1135554511 | 16:23424845-23424867 | CCCTCTCCACGCCGTTGCTGAGG | 0: 1 1: 0 2: 0 3: 5 4: 116 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1135554511 | Original CRISPR | CCCTCTCCACGCCGTTGCTG AGG | Exonic | ||