ID: 1135560195

View in Genome Browser
Species Human (GRCh38)
Location 16:23470250-23470272
Sequence ATGGAGAAGCAACAGCATCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 287
Summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 258}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135560195_1135560197 -7 Left 1135560195 16:23470250-23470272 CCCAGATGCTGTTGCTTCTCCAT 0: 1
1: 0
2: 0
3: 28
4: 258
Right 1135560197 16:23470266-23470288 TCTCCATGCAGAACATGTCCAGG 0: 1
1: 0
2: 0
3: 21
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135560195 Original CRISPR ATGGAGAAGCAACAGCATCT GGG (reversed) Intronic
900606109 1:3524257-3524279 ATGGGGAAGGATCAGCAGCTGGG + Intronic
901670994 1:10856398-10856420 TTATAGAAGCAACAGCAACTGGG + Intergenic
904497737 1:30896585-30896607 ATGAAGAGGGAACAGCATCTGGG + Intronic
905296978 1:36960545-36960567 ATGGCTAAGCAACCGCCTCTAGG + Intronic
905809084 1:40898939-40898961 ATGGAGAAGGATCAGGAGCTAGG - Intergenic
907214783 1:52853022-52853044 ATGGAGAAGCTACATCAACAGGG + Intronic
909047568 1:70728464-70728486 AGGGTGAGGCAACAGCATCCAGG - Intergenic
910090677 1:83459664-83459686 CTGCAGAAGCTGCAGCATCTGGG + Intergenic
912928186 1:113930920-113930942 ATAGACAAGAAAGAGCATCTAGG - Intronic
913988642 1:143588105-143588127 ATGGTGAAGCCACAGGCTCTGGG - Intergenic
915572918 1:156755018-156755040 AAGCAGCAGCAACAGCACCTTGG - Intronic
916355104 1:163897190-163897212 ATGGAGAAGCAAACTGATCTAGG + Intergenic
916519712 1:165552618-165552640 AGGCAGAAGCAACAGGATTTGGG + Intronic
916793736 1:168146587-168146609 ATGGAAAAGCATTACCATCTGGG - Intergenic
919920439 1:202163815-202163837 CTGGAGAAGCACTAGGATCTCGG + Intergenic
922408732 1:225347304-225347326 GTTGAGAAGCTACAGCATCCAGG + Intronic
924240579 1:242036221-242036243 ATGGAGATGCAGCAGCATTTGGG + Intergenic
1062952130 10:1512371-1512393 GTGTAGCAGCATCAGCATCTTGG - Intronic
1063078232 10:2738289-2738311 TTGGAGAGGCAACAGCATTGAGG - Intergenic
1063145360 10:3290667-3290689 AGGGAGAAGCCACAGGCTCTGGG + Intergenic
1063171598 10:3514720-3514742 ATGAAGAAGACACAGCCTCTCGG + Intergenic
1063533760 10:6862542-6862564 ATGGAGATGCCACAGTACCTCGG - Intergenic
1064648610 10:17485476-17485498 ATGGAGAACCTACAGCAACAGGG + Intergenic
1067486071 10:46651756-46651778 CTGGAGAACCAATAGAATCTGGG + Intergenic
1067563438 10:47320106-47320128 GTTGAGAAGCAACAGCAGGTGGG + Intergenic
1067608685 10:47689898-47689920 CTGGAGAACCAATAGAATCTGGG - Intergenic
1067682843 10:48451208-48451230 ATGGAGAAGCTGCAGCTTCGTGG + Intronic
1067983837 10:51118867-51118889 AGGGAAAAGCAACAGCATATTGG + Intronic
1068480329 10:57580800-57580822 ATGAAGAAGCTACATTATCTGGG + Intergenic
1068521771 10:58085047-58085069 GTGGACAGGCAACAGCATCAGGG - Intergenic
1069748102 10:70728783-70728805 TTGGAGCAGCAGCAGCACCTGGG - Intronic
1071883827 10:89928159-89928181 AGAGAGAAGCAAAAGCATCATGG + Intergenic
1073064525 10:100750265-100750287 GAGGAGAAGCAGCAGCATTTGGG + Intronic
1076132778 10:128025587-128025609 ATGGAGAAGCTGCAGGGTCTGGG - Intronic
1076540522 10:131211513-131211535 ATGGAGAAGTCACTGCATCCTGG - Intronic
1077546135 11:3170828-3170850 AGGGAGGAGCCACAGCATGTTGG + Intergenic
1079242031 11:18728258-18728280 ATGGAGAACCCAGAGGATCTAGG - Exonic
1081372676 11:42323417-42323439 ATGGGGCATCAACAGCATCTCGG - Intergenic
1082035484 11:47642255-47642277 GCGGAGGAGCAGCAGCATCTCGG + Intronic
1082623831 11:55459846-55459868 ATGAATAAGCAACAGGTTCTTGG - Intergenic
1083049394 11:59763414-59763436 CTGGAGAAGCAAAAGCAGGTAGG + Intronic
1084563219 11:69915607-69915629 CTGGAAAAGCAACCGCCTCTAGG + Intergenic
1085691299 11:78666127-78666149 AGTGAGAAGTAACAGTATCTTGG + Intronic
1087425728 11:97982951-97982973 ATGGAAAAACAAGAGCATATGGG - Intergenic
1087707845 11:101515018-101515040 ATGGAAAGGGAACAGCATCAAGG + Intronic
1088811714 11:113396786-113396808 AGGCAGAAGCCACAGCATCTGGG + Intronic
1089062899 11:115640595-115640617 ATAGAGAAGCAAGAGGTTCTTGG - Intergenic
1089138142 11:116265843-116265865 ATGGAGAAGCAAGAGCAAAGGGG + Intergenic
1089947585 11:122493616-122493638 ATGAAGAAGAAACAGACTCTTGG - Intergenic
1092818548 12:12332008-12332030 ATGGAGCAGGAGCAGGATCTGGG - Intronic
1094718272 12:33034476-33034498 ATTGAGAAGCGACAGCATTCTGG - Intergenic
1097406257 12:59194363-59194385 CTGGAGAAGCCTCAGAATCTTGG + Intergenic
1097745192 12:63293847-63293869 ATGGAAGAGCCACAGCAACTTGG + Intergenic
1097767975 12:63547418-63547440 ATGGATGAGCAAGACCATCTTGG - Intergenic
1097784335 12:63742484-63742506 ATGGATGAGCAAGACCATCTTGG - Intergenic
1098146091 12:67499176-67499198 AGGGAGAAGCTACACCATCTGGG + Intergenic
1100573578 12:95867396-95867418 ATGCAGAAGGAACAGCAGTTAGG + Intronic
1101065774 12:101018830-101018852 GTGGGGAAGCAAGAGCATCAAGG - Intronic
1104642008 12:130473416-130473438 CAGGAGCAGCAGCAGCATCTGGG + Intronic
1107105936 13:36642664-36642686 ATGGAGAAACAACAGTATCCTGG - Intergenic
1108504061 13:51094190-51094212 TTGGAGAAGTAACAGAATCCAGG - Intergenic
1109841771 13:67926351-67926373 ATGGAGAATAAACAGCACATGGG - Intergenic
1112672435 13:101655669-101655691 ATGGAGAAGCAAATGAATGTTGG - Intronic
1113651649 13:112037421-112037443 AGGGAGAACCAAGAGCAACTAGG - Intergenic
1114047134 14:18885156-18885178 ATGTAGAAGAAACAGCTTTTTGG - Intergenic
1114117081 14:19634253-19634275 ATGTAGAAGAAACAGCTTTTTGG + Intergenic
1114926311 14:27403790-27403812 ATGGAGAGTCAACTGTATCTAGG - Intergenic
1116535767 14:46027413-46027435 TTTGAGAACCTACAGCATCTTGG - Intergenic
1118718421 14:68576554-68576576 ATGGAGATGCTAAAGCATCCAGG + Intronic
1119946869 14:78704437-78704459 ATGCAGAAGCAATAACACCTGGG + Intronic
1121230562 14:92354533-92354555 ATGGAGAGGAAACAGCAAGTAGG + Intronic
1121236665 14:92396428-92396450 AAGGAGGAACAACAGCACCTTGG - Intronic
1121263106 14:92580890-92580912 CTGGAAAAAGAACAGCATCTGGG + Intronic
1121427404 14:93862321-93862343 ATGGAGAGGCAAAACCTTCTTGG + Intergenic
1125301046 15:38253135-38253157 ATGGAGGAGCAACAGCAGGCGGG - Exonic
1125709314 15:41771959-41771981 GTGGTTAAGCAACACCATCTAGG - Intronic
1127329329 15:57923328-57923350 CAGGAGAAACAACAGCATATTGG - Intergenic
1127483939 15:59402351-59402373 GTGGAGAGGTAACAGCATGTGGG + Intronic
1127970165 15:63952402-63952424 AAGGAAGAGCAGCAGCATCTGGG + Intronic
1129534149 15:76297888-76297910 AGAGAGAAGCTACAGCCTCTAGG + Intronic
1130550324 15:84886492-84886514 ATGGAGAAGCAGCAGCCAGTGGG + Intronic
1131142921 15:89992301-89992323 ATGCAGCAGCAGCACCATCTGGG - Intergenic
1131880176 15:96853987-96854009 ATGGAGAAGAATGTGCATCTTGG - Intergenic
1133124999 16:3641058-3641080 CAGGAGCAGCAACAGCACCTGGG - Intronic
1135560195 16:23470250-23470272 ATGGAGAAGCAACAGCATCTGGG - Intronic
1135669766 16:24365417-24365439 AAGGGGAAGCAGCAGCATCCAGG + Intergenic
1138558787 16:57787954-57787976 ATGGGGAAGCAGCATCCTCTAGG - Intronic
1138563020 16:57813384-57813406 AAGGAGAAGCCAGAGGATCTTGG + Intronic
1138812591 16:60168189-60168211 ATGCAGTAGCAGCATCATCTGGG - Intergenic
1140975335 16:80054651-80054673 ATGGAGAAAAAACAGCATTTAGG - Intergenic
1142153240 16:88521831-88521853 ATGGAGAGGGAACAGCATAGGGG - Intronic
1142421063 16:89970471-89970493 TTGGAGAAACTACAGCATCATGG - Exonic
1143567208 17:7730462-7730484 ATGCAGAAGGAACTGAATCTGGG + Intronic
1147465867 17:40610290-40610312 ATGGAGAAGTAGCAGCCTCATGG + Intergenic
1148345470 17:46900613-46900635 TTGGAGAAGGAGCAGCATTTAGG + Intergenic
1151390415 17:73783331-73783353 CTGGACCAGCAGCAGCATCTGGG - Intergenic
1157806896 18:50665072-50665094 ACTGAGAAGCAAGAGCATCACGG - Intronic
1161162270 19:2768039-2768061 TTGGAGGTGCAACAGCATCCGGG - Intronic
1161814241 19:6489566-6489588 ACGGAGCAGCAAAGGCATCTGGG - Intergenic
1162179179 19:8855646-8855668 GTGGAGGAGCAATACCATCTAGG + Intronic
1162788737 19:13052222-13052244 CTGGAGGACCAACAGCACCTGGG - Intronic
1163294958 19:16405987-16406009 AGGGAGAGGCAGCAGCAGCTGGG + Intronic
1163353015 19:16791316-16791338 ATGAAGAGGAAGCAGCATCTTGG - Intronic
1165661752 19:37586938-37586960 ATGGGAAAGTAACAGCACCTAGG - Intronic
1167481434 19:49734204-49734226 AGGGAAAAGCAACTTCATCTTGG - Intergenic
927485572 2:23486342-23486364 AGGGATAAGCCCCAGCATCTCGG - Intronic
929350855 2:40952652-40952674 ATGGAAAATCTACAGGATCTGGG - Intergenic
929484069 2:42339310-42339332 ATGGAGGAGCAAGAGCCGCTGGG - Intronic
930186895 2:48420001-48420023 AGGCAGAGCCAACAGCATCTCGG + Intergenic
930553871 2:52870480-52870502 ATGGGGAAGCACCATCCTCTTGG + Intergenic
931816953 2:65914036-65914058 CTGCAGTAGCAACGGCATCTGGG + Intergenic
932689507 2:73900302-73900324 AAGGAGAAGCAACAGAGCCTCGG - Intronic
933026411 2:77264967-77264989 ATGGTAAAACAACAGGATCTTGG + Intronic
933781007 2:85801175-85801197 ATGGAGGAGCAACAACATAGAGG + Intergenic
935617324 2:105100169-105100191 GTGGGGAAGCAACAGAATCAGGG - Intergenic
936160053 2:110078058-110078080 CTGGAGAAGCAGCAGGATTTGGG - Intergenic
936184611 2:110293295-110293317 CTGGAGAAGCAGCAGGATTTGGG + Intergenic
936653213 2:114454142-114454164 ATGGGCAAGCAATAGCAGCTTGG + Intronic
937612548 2:123879294-123879316 AAGGAGAAGCAACAGACTCCTGG - Intergenic
938424514 2:131173697-131173719 ATGTAGAAGAAACAGCTTTTTGG - Intronic
941323650 2:164086342-164086364 AAGAAAAACCAACAGCATCTTGG + Intergenic
941562797 2:167069694-167069716 ATGGGCAAGAAACAGAATCTAGG - Intronic
942549259 2:177097491-177097513 ATGAAGAAACAACAGAATTTAGG - Intergenic
943434438 2:187847115-187847137 ATGTAGAAGCATTTGCATCTAGG - Intergenic
945139356 2:206667342-206667364 CTGGGGAAGAAACAGCATCCAGG - Intronic
946943479 2:224794978-224795000 CTGGAGATCCACCAGCATCTCGG + Exonic
1169575434 20:6955128-6955150 ATTGGTAAGCAACAGCATCTAGG + Intergenic
1169691027 20:8332267-8332289 ATGCAGAAGCAGAGGCATCTGGG - Intronic
1170657189 20:18298821-18298843 ATTGAAAAGCAACTGCATATGGG + Intronic
1170921790 20:20686187-20686209 ATGCAGAAGCCACAGGACCTTGG + Intronic
1172300546 20:33846699-33846721 ATGGAGAAACCACAGCCTCATGG + Intronic
1172311810 20:33924229-33924251 CTGGAGAAGCGACAGCAGCCAGG + Intergenic
1173281458 20:41631914-41631936 CTGGACCAGCAGCAGCATCTAGG + Intergenic
1173448351 20:43139822-43139844 GTGGAGCAGCATCGGCATCTGGG + Intronic
1174436434 20:50510383-50510405 ATGAAGAAGCAGCAGCGGCTAGG + Exonic
1175427769 20:58880271-58880293 ATGGATTCGGAACAGCATCTGGG - Intronic
1176007176 20:62872151-62872173 TTGGTTAAGAAACAGCATCTGGG - Intergenic
1179840849 21:44072312-44072334 ATGCAGAAGCAAGAGCAGCCAGG - Intronic
1180465667 22:15607807-15607829 ATGTAGAAGAAACAGCTTTTTGG - Intergenic
1181905977 22:26196748-26196770 AGGGAGAAGCAACAGGTTCAAGG + Intronic
1182243693 22:28937651-28937673 CTGCAGTAGCAGCAGCATCTGGG - Intronic
1182827684 22:33279761-33279783 ATGGAAAAGCAACTGCTTCTGGG - Intronic
1183302650 22:37065884-37065906 ATGGAGAAGTGCCAGCAGCTGGG - Exonic
1184344932 22:43907456-43907478 ATGGAGGAGCCACAGCTGCTTGG - Intergenic
1184836175 22:47022452-47022474 CTGGGGAAGCCACGGCATCTGGG + Intronic
950881181 3:16323713-16323735 AATGGGAAGTAACAGCATCTTGG + Intronic
951804662 3:26631170-26631192 TTGGAGAAGCAATAGCCTCCTGG + Intronic
953119257 3:40023832-40023854 AAGGAGAAAGAACAGTATCTAGG - Intronic
953257356 3:41304768-41304790 CTGGAGAAGCGACAGGATCCTGG - Intronic
953591723 3:44263022-44263044 TTGGAGAAGCATCATCATGTAGG + Intronic
956871914 3:73426828-73426850 CTGGCCCAGCAACAGCATCTGGG - Intronic
957409407 3:79818152-79818174 ATGGAGAAATAACAGCATCAAGG + Intergenic
960782330 3:121333172-121333194 ATGGAGAAAATAAAGCATCTAGG + Intronic
963722860 3:148883754-148883776 ATAGGGAAACAATAGCATCTGGG - Exonic
963864410 3:150344727-150344749 ATGGAGAAAAATCAGCCTCTGGG - Intergenic
965395756 3:168159059-168159081 AAGGAGAAACACCAGAATCTTGG + Intergenic
965432086 3:168601518-168601540 ATGGAAATGCATCAACATCTGGG - Intergenic
967520764 3:190429651-190429673 ATGGAGCAGGAACAGGATATAGG + Exonic
969248878 4:5954318-5954340 ATGGGGAAGCAGCAGCAGCTGGG + Intronic
969687236 4:8682475-8682497 ATTGAGAAGCAGCAGCACCAGGG + Intergenic
970781034 4:19737947-19737969 AAAGAGAAGCAGCAGAATCTAGG - Intergenic
971546049 4:27889028-27889050 ATGGAGAAGAAATAGTAGCTTGG + Intergenic
971662391 4:29436311-29436333 ATGAAGAAGCGACAGAATTTTGG - Intergenic
971912682 4:32814725-32814747 ATGAATTAGGAACAGCATCTCGG - Intergenic
973742550 4:53932466-53932488 ATGGAGAGGCATGAGCATTTTGG - Intronic
973840662 4:54857169-54857191 AGAGAGAAGCAACAGCAGCATGG + Intergenic
974220075 4:58957353-58957375 ATGGTGAAGCAACATCATCCAGG - Intergenic
975011720 4:69363117-69363139 GTGCAGCAGCAACACCATCTCGG - Intronic
975407299 4:74004607-74004629 ATGAAGAAGCAGCATCATCCAGG + Intergenic
975472613 4:74787801-74787823 TTAGAGTAGCAACAGCACCTGGG - Intronic
975605653 4:76151399-76151421 ATAGAGCAGCAAAAGCAGCTTGG + Intergenic
977500905 4:97835395-97835417 ATGGACAACCAACAGCCCCTAGG + Intronic
977839683 4:101687451-101687473 AGGGAGAAGCCACAGCAACTTGG - Intronic
979112226 4:116774375-116774397 AAGTAGGAGAAACAGCATCTTGG - Intergenic
979699734 4:123654378-123654400 ATGGGGAAGCATCACCATCATGG - Intergenic
981390002 4:144178284-144178306 CAAGAGAAGAAACAGCATCTAGG + Intergenic
981921625 4:150090971-150090993 ATGGAGTGGGAACAGCATCTGGG + Intronic
983780792 4:171667766-171667788 ATAGAGAAGCAACCTCATCTTGG - Intergenic
984412781 4:179416049-179416071 ATGGGGAAGAAACAGGATCCAGG - Intergenic
984639943 4:182151689-182151711 ACGAAGAAACAAAAGCATCTTGG + Intronic
984732385 4:183079832-183079854 ATGGAGAAGCAGCAGGAGCCAGG + Intergenic
986348572 5:6856421-6856443 AAGGAGAAGAAACATCATCGGGG - Intergenic
986536844 5:8796971-8796993 TAGGAGATGCTACAGCATCTGGG - Intergenic
987157461 5:15104442-15104464 TTGGGAATGCAACAGCATCTGGG + Intergenic
988942124 5:36157319-36157341 ATGAAGAAACAACAGAAGCTGGG - Intronic
989023827 5:37042682-37042704 AAGGAGAAGCACCAGCATGTCGG - Intronic
989416748 5:41186931-41186953 TTGGAAAAGCATTAGCATCTTGG - Intronic
989540548 5:42613297-42613319 ACGGAGAAACAACAGCAGCAAGG - Intronic
990328278 5:54699348-54699370 ATGGAGAAGAATCACCATCTTGG - Intergenic
991218064 5:64179019-64179041 AAGGAGCAGCAACAACACCTGGG - Intronic
992637709 5:78740800-78740822 ATGAACAAGCAACTGCAACTGGG + Intronic
992647912 5:78829412-78829434 ATGAAGAAGTGACAGCATTTGGG - Intronic
993314827 5:86388968-86388990 ATGGAGAAGCAACAAGCTCAGGG - Intergenic
993603078 5:89952950-89952972 CAGGAAAAGTAACAGCATCTGGG + Intergenic
995184133 5:109254059-109254081 CTGTAGAAGCAACACCATCAGGG - Intergenic
996731119 5:126718412-126718434 ATGGAGACTGAACAGCCTCTGGG - Intergenic
997031996 5:130141054-130141076 CTGGAGAAGCTACAAAATCTTGG - Intronic
997334730 5:133098962-133098984 ATGTAAAAGCAAGTGCATCTGGG - Intronic
999893899 5:156008010-156008032 ATGGAGAAAAAAAAGAATCTTGG - Intronic
1000586820 5:163110422-163110444 ATGGAGAACCAACAGTAGTTAGG + Intergenic
1001657759 5:173365556-173365578 TTGCAGCAGCGACAGCATCTTGG + Intergenic
1002203722 5:177548073-177548095 AGGCAGAAGGAACAGCATATGGG - Intronic
1002622795 5:180500961-180500983 AGGGAGAAGGAACAGCATATTGG + Intronic
1003525888 6:6896974-6896996 ATGGAGGAGAAACAGTCTCTTGG + Intergenic
1005141471 6:22636725-22636747 TAAGAGAAGCAACAGGATCTTGG - Intergenic
1005347947 6:24908990-24909012 AGAGAGAAGCAACAGCAATTGGG + Intronic
1007838202 6:44693813-44693835 TTGGAGCAGCAACAGAATGTCGG + Intergenic
1007914137 6:45545121-45545143 AAGGAGAAGCAACAGCCTTAGGG - Intronic
1008071622 6:47104269-47104291 ATGAAGAAGCATAGGCATCTTGG + Intergenic
1009798271 6:68500522-68500544 ATGGCGATGCAACAGCAACAGGG + Intergenic
1011173870 6:84538616-84538638 ATGGAGAAAGAACAGAATATTGG - Intergenic
1012271168 6:97213509-97213531 AAGGAGAAGCAATAGCAGCTGGG + Intronic
1015210663 6:130694865-130694887 ATGGAGAAGCAGCAGCAGGAAGG + Intergenic
1016226082 6:141739915-141739937 TTGGAGAAGCGACTGCATCTAGG - Intergenic
1016863871 6:148747434-148747456 AAGAAGAAGCAGCAGCATCCCGG + Exonic
1018001963 6:159587396-159587418 AAAGAAAAGCAACAGCCTCTTGG - Intergenic
1018932906 6:168253553-168253575 CAGGAGAAGCACCATCATCTCGG - Intergenic
1019452197 7:1105154-1105176 ATGGACAAGCCACAGGCTCTGGG + Intronic
1021027194 7:15685073-15685095 ACTGCGAAGCAACAGCAACTCGG - Intronic
1021763575 7:23924975-23924997 TTGGAAATGCAGCAGCATCTAGG - Intergenic
1022227902 7:28382343-28382365 ATTTAGAAGCAAAACCATCTGGG + Intronic
1022534412 7:31086845-31086867 ATGGGGGAGCAATAGCCTCTCGG + Intronic
1023869541 7:44255613-44255635 ATAGAGAAGCCACAGCACCTGGG - Intronic
1024017121 7:45327221-45327243 ATTGAAAGGCAGCAGCATCTTGG + Intergenic
1024786730 7:52915870-52915892 ATTGAGAAGAACCAGTATCTTGG + Intergenic
1027307525 7:76916131-76916153 CTGCAGAAGCTGCAGCATCTGGG + Intergenic
1028088033 7:86661051-86661073 ATGGAGTATAAACAGCATCATGG + Intronic
1030982266 7:116200131-116200153 ATGGATAAGGAAGGGCATCTCGG + Intergenic
1033353521 7:140581562-140581584 ATGGAGTATCTACCGCATCTGGG - Intronic
1034131377 7:148721346-148721368 ATAGAAAAGCAAAAGCATTTAGG - Intronic
1034730958 7:153387138-153387160 ATGTGGAAGCAAAAGCATCAAGG + Intergenic
1035252540 7:157606471-157606493 ATCTGGAAGCAACAACATCTCGG + Intronic
1036504110 8:9339640-9339662 ATGGAGAGGCAACATCAAGTTGG + Intergenic
1036782767 8:11660862-11660884 ATGCAGGAACAACAGCCTCTTGG + Intergenic
1039157907 8:34582644-34582666 ATGGAGAAGCCACAGAGACTGGG + Intergenic
1039873184 8:41564661-41564683 AAGAAGAAGTAACATCATCTTGG + Intergenic
1044169883 8:89036836-89036858 ATGGAAAGGCTACAACATCTAGG + Intergenic
1044295723 8:90525042-90525064 ATGTAGAAGAAACAGCATTGTGG + Intergenic
1045052262 8:98338026-98338048 ATGGAGAAAGAACATCATCAAGG - Intergenic
1046676273 8:117112011-117112033 AGAGACAAGCAGCAGCATCTGGG + Intronic
1047297122 8:123580989-123581011 ATGGAGAAGGAAGAGCAGGTGGG + Intergenic
1048141509 8:131799405-131799427 ATGGAGAAGAAAAAGCTTCCAGG - Intergenic
1050336608 9:4595725-4595747 ATACAGAAGCAACAGTATCTTGG + Intronic
1052335509 9:27315435-27315457 CTGTAGAGGCAACAGCATTTAGG - Intergenic
1055199839 9:73646665-73646687 ACGGACTAGCAACAGCATGTTGG - Intergenic
1055694545 9:78869917-78869939 CTGCACAAGCAACTGCATCTGGG - Intergenic
1057139052 9:92715867-92715889 ATGGAGAAGCCATGGCTTCTAGG + Intronic
1057373100 9:94491713-94491735 TTGGACAAGCAACAACACCTGGG - Intergenic
1058619356 9:106865956-106865978 ATGGAAAAGCAACATCTTCATGG - Intronic
1061570912 9:131476961-131476983 GTGGAGAAGCAGAACCATCTAGG - Intronic
1185619879 X:1447327-1447349 TTGGATAAGCACCACCATCTTGG + Intronic
1185619886 X:1447381-1447403 TTGGAGAAGCACCACCATCTTGG + Intronic
1185619891 X:1447419-1447441 TTGGATAAGCACCACCATCTTGG + Intronic
1185619899 X:1447473-1447495 TTGGAGAAGCACCACCATCTTGG + Intronic
1185619906 X:1447511-1447533 TGGGAGAAGCACCACCATCTTGG + Intronic
1185619914 X:1447565-1447587 TTGGATAAGCACCACCATCTTGG + Intronic
1185619922 X:1447619-1447641 TTGGATAAGCACCACCATCTTGG + Intronic
1185619930 X:1447673-1447695 TTGGAGAAGCACCACCATCTTGG + Intronic
1185619945 X:1447784-1447806 TTGGATAAGCACCACCATCTTGG + Intronic
1185619968 X:1447950-1447972 TTGGAAAAGCACCACCATCTTGG + Intronic
1185619989 X:1448096-1448118 TTGGATAAGCACCACCATCTTGG + Intronic
1185619997 X:1448150-1448172 TTGGATAAGCACCACCATCTTGG + Intronic
1185620003 X:1448188-1448210 TTGGATAAGCACCACCATCTTGG + Intronic
1185620010 X:1448242-1448264 TTGGATAAGCACCACCATCTTGG + Intronic
1185620017 X:1448296-1448318 TTGGATAAGCACCACCATCTTGG + Intronic
1185620029 X:1448369-1448391 TTGGACAAGCACCACCATCTTGG + Intronic
1185620041 X:1448441-1448463 TTGGAAAAGCACCACCATCTTGG + Intronic
1185620047 X:1448495-1448517 TTGGATAAGCACCACCATCTTGG + Intronic
1185620055 X:1448552-1448574 TTGGATAAGCACCACCATCTTGG + Intronic
1185620063 X:1448606-1448628 TTGGATAAGCACCACCATCTTGG + Intronic
1185620069 X:1448644-1448666 TTGGATAAGCACCACCATCTTGG + Intronic
1185620076 X:1448698-1448720 TTGGAGAAGCACCACCATCTTGG + Intronic
1185620085 X:1448752-1448774 TTGGATAAGCACCACCATCTTGG + Intronic
1185620091 X:1448790-1448812 TTGGATAAGCACCACCATCTTGG + Intronic
1187044680 X:15635050-15635072 ATAGAGAAGCAACCTCTTCTAGG + Intronic
1189452527 X:41151108-41151130 ATTGAAAAGAAACAGCATATTGG + Intronic
1190853869 X:54273820-54273842 ATGGTGAATTAACAGCAGCTAGG + Intronic
1191741195 X:64436823-64436845 ATGGACAAGCATCCTCATCTTGG + Intergenic
1192219082 X:69184790-69184812 ATGCAGAAGGAACAACATATGGG - Intergenic
1192468679 X:71377537-71377559 ATGGGAAAACAGCAGCATCTGGG - Intronic
1193870365 X:86789777-86789799 ATGGAGATGCTACAGCATAGAGG + Intronic
1196679239 X:118453963-118453985 CTGGAGAAGCAGCAGCAGCTGGG + Intergenic
1197668365 X:129248000-129248022 ATGCAAAAGCAACAGGAGCTAGG + Intergenic
1197893266 X:131286371-131286393 ATGGAGACACGCCAGCATCTTGG + Intronic
1198388466 X:136149269-136149291 CTGAAGAAGCAAGAGCTTCTGGG + Intronic
1199848015 X:151705530-151705552 ATTGAGAGGCAAAAGCAGCTGGG - Exonic
1202044827 Y:20727450-20727472 ATGGAGAGGCAACAGTAAATGGG + Intergenic