ID: 1135564159

View in Genome Browser
Species Human (GRCh38)
Location 16:23499069-23499091
Sequence AAGGCTCTGGATTCTGTGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 223}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135564159_1135564163 -8 Left 1135564159 16:23499069-23499091 CCCCTCACAGAATCCAGAGCCTT 0: 1
1: 0
2: 2
3: 14
4: 223
Right 1135564163 16:23499084-23499106 AGAGCCTTCTCACTCCTCCCTGG No data
1135564159_1135564170 24 Left 1135564159 16:23499069-23499091 CCCCTCACAGAATCCAGAGCCTT 0: 1
1: 0
2: 2
3: 14
4: 223
Right 1135564170 16:23499116-23499138 GAAAGAGACACAGCACTGACGGG 0: 1
1: 0
2: 1
3: 26
4: 354
1135564159_1135564169 23 Left 1135564159 16:23499069-23499091 CCCCTCACAGAATCCAGAGCCTT 0: 1
1: 0
2: 2
3: 14
4: 223
Right 1135564169 16:23499115-23499137 TGAAAGAGACACAGCACTGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135564159 Original CRISPR AAGGCTCTGGATTCTGTGAG GGG (reversed) Intronic
900936629 1:5770222-5770244 GAGGCTCTGGATCCCGTGACTGG + Intergenic
900962835 1:5936715-5936737 AAGGGCCTGTTTTCTGTGAGCGG - Intronic
901423499 1:9166400-9166422 AAGGCTCTGTATCCCGTGAAAGG - Intergenic
901863905 1:12091505-12091527 CAGGCTCTGGGTGCTCTGAGAGG + Intronic
903617446 1:24671250-24671272 AAGGCTTTGGAGGGTGTGAGTGG - Intronic
903688169 1:25147963-25147985 ATTGCTCTGGATGCTGTGGGGGG + Intergenic
906194447 1:43921079-43921101 AAGGCCCTGGGTTCAGTGGGAGG - Intronic
907701600 1:56793556-56793578 AAGGCACTGGAGACTATGAGAGG + Intronic
909129702 1:71719134-71719156 AAGCCTTTGGTTTCTGTGAAAGG + Intronic
909875236 1:80794355-80794377 AAGGCACTGGCTTATGAGAGCGG + Intergenic
909956086 1:81780858-81780880 AAAGCTCTTTATTCTGTGGGGGG - Intronic
910098238 1:83548529-83548551 AAGGCTCTAGATTCTGGGCTGGG + Intergenic
911323294 1:96440257-96440279 AATGAGGTGGATTCTGTGAGGGG + Intergenic
913413991 1:118584563-118584585 CAGGGTCTGGAGTCTGTAAGGGG - Intergenic
914435490 1:147655722-147655744 AAGGCTATGGGGTCTCTGAGAGG - Intronic
916436909 1:164785858-164785880 AAGGCTCTGGGTGCTGGGAAAGG - Intronic
917722262 1:177796934-177796956 AAGGCTCAGTATTCTGGGAAAGG + Intergenic
919892989 1:201989633-201989655 AAGGCTCTGGACTCAGACAGAGG - Intronic
921466942 1:215499728-215499750 AAAGCTCTTTATTCTGTCAGTGG + Intergenic
922704205 1:227780435-227780457 AAGGCTCTTGGGTGTGTGAGAGG + Intronic
923676816 1:236087523-236087545 AAGGCTCAGGAACCTGTGAGTGG - Intergenic
1066348482 10:34613585-34613607 AATCCTCTGGATGCTGTGTGGGG - Intronic
1067689922 10:48495183-48495205 AAGGCTCAGGGTTCAGTGAATGG + Intronic
1068816285 10:61318318-61318340 AAGGTTCTAGATTCTATGATGGG + Intergenic
1070027552 10:72646502-72646524 AAGGCTCTGGATTCCTTGAGTGG - Intergenic
1070648693 10:78219508-78219530 TAGCCTCTGGCTTCTGTGATAGG + Intergenic
1074336693 10:112583551-112583573 AAGGCTGTGGGTGCTGTGAATGG + Intronic
1074394545 10:113086880-113086902 AAGACTTTGTATTCTGTAAGAGG + Intronic
1074950797 10:118333078-118333100 AAGCCTCTGCATTGTCTGAGAGG + Intronic
1075579745 10:123608306-123608328 GAGCCTCTGTAATCTGTGAGTGG + Intergenic
1076355266 10:129848090-129848112 AATATTTTGGATTCTGTGAGGGG - Intronic
1076799751 10:132815214-132815236 AAGGCCCTGGAACCAGTGAGGGG - Intronic
1077535376 11:3121652-3121674 ATTGCTCTGGCTTCTGGGAGAGG - Intronic
1079234990 11:18681771-18681793 AAGGGACTGGAGTCAGTGAGAGG + Intergenic
1079407773 11:20160592-20160614 GAGGCTCTGGACTCTCTGATTGG + Exonic
1081721185 11:45289797-45289819 AAGGCTCTGGCTTCTGTGGCAGG - Intergenic
1087518542 11:99199819-99199841 AAGGATGTGGATTCGGGGAGAGG + Intronic
1088036284 11:105320099-105320121 AAAGTTCTGGATTCTTTCAGGGG - Intergenic
1089420315 11:118327761-118327783 AAGGCTGTGTATTCTGTTGGTGG - Intergenic
1089531806 11:119134704-119134726 AGGACTCTGGATTCTTTGAGGGG + Exonic
1089605450 11:119638772-119638794 AAGGCTCCGGCTTCTGGGAGAGG + Intronic
1090550901 11:127818869-127818891 AAGGCTGTTGATACTGTCAGTGG - Intergenic
1090643408 11:128748091-128748113 ATGGCTCTGGATTCTGTTACAGG + Intronic
1093574144 12:20707082-20707104 AGGGCTCAGAATTCTCTGAGTGG + Intronic
1094631528 12:32180218-32180240 AATCCTCTGGATTCTTTAAGAGG - Intronic
1095905392 12:47372080-47372102 AATGCTCTTCATTCTGTCAGAGG - Intergenic
1096146471 12:49282383-49282405 GAGGCTCTGGGGCCTGTGAGAGG + Intergenic
1097261152 12:57720928-57720950 AAGAGTCTGGATTCCGTGAAGGG - Exonic
1099804745 12:87504871-87504893 AAGGCTCTGCATTCTGTGAAAGG - Intergenic
1102522919 12:113490374-113490396 AAGGCTTTTGAGTCTCTGAGGGG + Intergenic
1104648209 12:130511966-130511988 CAAGCTCAGGCTTCTGTGAGGGG + Intronic
1105014380 12:132777292-132777314 GAGTCTCTGGGATCTGTGAGGGG - Intronic
1106466835 13:30021150-30021172 GAGCATCTGGATTCTGTGTGGGG + Intergenic
1106837794 13:33654523-33654545 AATGCTCTGGAATTTGTTAGTGG + Intergenic
1106935068 13:34709297-34709319 AAGGCCTTGGATTTGGTGAGGGG - Intergenic
1107189003 13:37557393-37557415 AAGACTCTGTATTCAGTAAGTGG + Intergenic
1108712098 13:53043598-53043620 AAGCCTCTGGAATCTGTGTGTGG + Intronic
1108842331 13:54634793-54634815 TATGCTCTTCATTCTGTGAGTGG - Intergenic
1111279966 13:86009708-86009730 AAGGATCAGGAGTCAGTGAGGGG + Intergenic
1116287888 14:42996238-42996260 AAGGCACTGCATTCTCTGAATGG + Intergenic
1116777873 14:49202395-49202417 AAGGCTGTGGACTCTCTGATTGG - Intergenic
1117479530 14:56129109-56129131 AAGGCTGTGGCCTCTGGGAGGGG + Intronic
1121209476 14:92197286-92197308 AAGGGTCTGGAGGCTGGGAGAGG + Intergenic
1121810115 14:96878808-96878830 AAGGCTCCTCATTTTGTGAGGGG - Intronic
1122307025 14:100772865-100772887 GAGGCTGTGGATGCTGAGAGAGG + Intergenic
1126349481 15:47729657-47729679 TAGGCTCTGGATTTTCTGATTGG - Intronic
1126534799 15:49749713-49749735 AGGGCTCTGGATACTGTGAAAGG + Intergenic
1128645905 15:69378870-69378892 AAGGCCATGGATGCTGTGAAAGG + Intronic
1130313209 15:82772310-82772332 AAGGCTGTGGATTCATTGGGGGG - Intronic
1130828284 15:87572405-87572427 AAGGCCCTGGAATCTGGGTGTGG - Intergenic
1132884575 16:2177002-2177024 CAGGCACTGGCTGCTGTGAGTGG + Exonic
1133235256 16:4384645-4384667 GAGGCTCTGGATTCAATTAGCGG + Intronic
1133617695 16:7493718-7493740 AGGGCTCTGGAGGCTCTGAGAGG - Intronic
1134141508 16:11723770-11723792 AAGGCTCGGGAATCTTTTAGGGG - Intronic
1135564159 16:23499069-23499091 AAGGCTCTGGATTCTGTGAGGGG - Intronic
1136156854 16:28388836-28388858 AAGGTTCTGGGTCCTGGGAGTGG - Intronic
1136206232 16:28726445-28726467 AAGGTTCTGGGTCCTGGGAGTGG + Intronic
1137365907 16:47859287-47859309 AAGGATTTGGACTCTGGGAGAGG - Intergenic
1141676777 16:85521946-85521968 ATGCCCCTGGCTTCTGTGAGCGG - Intergenic
1143336948 17:6178590-6178612 CAGGCTGTGGACTCTGTTAGAGG - Intergenic
1143854572 17:9839245-9839267 AAGGGTCTGGATTCTGGCAAGGG + Intronic
1144904206 17:18626692-18626714 AAGGCCATGTAGTCTGTGAGGGG - Intergenic
1144947896 17:18979119-18979141 AAGGCCCTGGACACTGTGGGGGG + Intronic
1147340704 17:39751858-39751880 AACGCTCTGGACTCTGGGATGGG + Intergenic
1148255552 17:46128270-46128292 AAGGCACAAGGTTCTGTGAGAGG - Intronic
1148385070 17:47228381-47228403 GAGGCTCTGGCCTCTGTCAGGGG - Intergenic
1148566983 17:48639153-48639175 AAGGCTGTGACTTCTGTTAGTGG - Intergenic
1151476791 17:74348746-74348768 AACTCTCTGGAGACTGTGAGTGG + Intronic
1151608075 17:75153258-75153280 AAGGGTTTGGATTCTGTGGAAGG - Intronic
1151789290 17:76293894-76293916 CAGGCTCTGGATTCTGCCAGTGG - Exonic
1152594337 17:81230888-81230910 AGGGCTCTGGTGTCTGGGAGCGG - Intronic
1153707114 18:7757284-7757306 AAGGGTCAGGATTCTGTGTTGGG + Intronic
1153972513 18:10239353-10239375 AAGAATGTGGAGTCTGTGAGAGG + Intergenic
1157883211 18:51341716-51341738 AAGACTCTTGTTTTTGTGAGGGG + Intergenic
1158198933 18:54918665-54918687 AAGGCTCTGGAGTATTTGGGAGG + Intronic
1160016395 18:75144017-75144039 GAGGCACTGGATCCTGGGAGTGG - Intergenic
1160115405 18:76074618-76074640 AGGGCTCTGCATTCTGGGAAAGG - Intergenic
1160718408 19:586828-586850 AAGGCACTGGGAGCTGTGAGTGG + Intergenic
1162897908 19:13776412-13776434 CACCCTCTGGCTTCTGTGAGAGG - Intronic
1165012692 19:32860112-32860134 ACTGCTCTGGAGTCTGAGAGAGG - Intronic
1165408642 19:35645008-35645030 AGGCCTCTGGATCATGTGAGAGG - Intergenic
1167160898 19:47766468-47766490 AAGGGTGTGGATTCTGGCAGTGG + Intergenic
927048431 2:19303351-19303373 ATGGCTCTGGAGTCTGAGTGAGG + Intergenic
927341017 2:21982953-21982975 TAGGCTTTGGAGTCTGTGATGGG + Intergenic
927716245 2:25355229-25355251 ATGGGTCAGGAATCTGTGAGTGG + Intergenic
928823831 2:35394625-35394647 ACAGCTTTGGATTCTGTGAAAGG + Intergenic
929564652 2:42976777-42976799 AAGGGTCTGGCTGGTGTGAGTGG + Intergenic
930173947 2:48282030-48282052 GTGGCACTGGATTCTGGGAGAGG - Intergenic
932919728 2:75897496-75897518 AGGACTCTGGAATCTGTGTGTGG - Intergenic
936254829 2:110902801-110902823 TGGGCTGTGGACTCTGTGAGAGG + Intronic
937076081 2:119107926-119107948 AAGGCCCTGGATTCAGAAAGTGG + Intergenic
937591134 2:123614623-123614645 CAAGCTCTGAATTCTGGGAGGGG - Intergenic
938986523 2:136581629-136581651 AAGGACCTGGAGTCTCTGAGTGG - Intergenic
940058000 2:149533918-149533940 AAAGCTCTGTGTTCTGGGAGTGG - Intergenic
944052936 2:195491768-195491790 AGGGCTGTGGATTCTGTAAATGG + Intergenic
944061445 2:195573194-195573216 AAGGCTCTGGATGGTGAGAAGGG + Intergenic
944210231 2:197199114-197199136 GAGGCTCTGGTTTCTGTGGTGGG - Intronic
944748007 2:202677535-202677557 TAGGCTATGAATTCTGTGAGAGG + Intronic
945437386 2:209834990-209835012 ACTGCTCTGGAGTCTGTGAGGGG - Exonic
945466400 2:210174851-210174873 TAGGCTTTCTATTCTGTGAGAGG - Intergenic
946759410 2:222978203-222978225 ATTGCTCTGGATTCTGACAGTGG + Intergenic
948903059 2:240965826-240965848 CAGGCTGTGGATTCGGTGACAGG - Intronic
1169119171 20:3084971-3084993 AGCGCTCTGGATTCAGGGAGAGG + Intergenic
1169314339 20:4576054-4576076 AAAGCTCAGGATGCTGGGAGTGG + Intergenic
1169644839 20:7798527-7798549 AAGGCTCTGGATACAGAGAGGGG + Intergenic
1171238755 20:23548362-23548384 CAGGCTCTGGATTAGGGGAGGGG + Intergenic
1171242850 20:23585876-23585898 CAGGCTCTGGATTAGGGGAGGGG - Intergenic
1173523498 20:43715839-43715861 AAGGCTCTGGCTTCTAGGGGAGG + Intronic
1173553167 20:43947551-43947573 GAGGCTCTGGAATCTGTTTGGGG + Intronic
1173806218 20:45927080-45927102 CAGGCTCTGGTTTCTGTGGTGGG - Intergenic
1174893237 20:54420699-54420721 ATGACTCTGGCTTCTGTGTGAGG + Intergenic
1177496414 21:21897455-21897477 AAGGGTGTGGATTCAGGGAGAGG - Intergenic
1179312954 21:40212963-40212985 AAGCCTCTGGAGGCTGGGAGAGG + Intronic
1179516505 21:41912022-41912044 TAGGTTCTGGATTCAGTCAGAGG + Intronic
1179609164 21:42538263-42538285 AATGCTCTTGAGTCTGTGTGTGG + Intronic
1180003616 21:45008118-45008140 AAAGGTCTGGATCCTGTGGGAGG + Intergenic
1181155950 22:20920828-20920850 AAGGCCCTATAATCTGTGAGGGG - Intronic
1184996455 22:48210736-48210758 AAGGCTCTGACTTCTGGCAGAGG - Intergenic
949325658 3:2860763-2860785 TAGACTTTGGATTCTGAGAGAGG - Intronic
950138242 3:10598124-10598146 AAGGGACAGGATTCTCTGAGAGG + Intronic
952192477 3:31038550-31038572 AAGGGTGTGGATTCTGGAAGGGG - Intergenic
953448254 3:42985758-42985780 GAGGATCTGGATTCTGTCAAGGG + Intronic
953968001 3:47325011-47325033 ATGGCTCTGGAGTCTGTGGCAGG - Intronic
955592834 3:60556427-60556449 AAGGCTCTTGTTGCTGTGAAAGG - Intronic
955769065 3:62371760-62371782 AAGGCTCTGGTTTCTGAAGGGGG - Intronic
956279020 3:67536696-67536718 TGGGCTCAGGAGTCTGTGAGAGG - Intronic
956810300 3:72858014-72858036 AAGACTCTGGATGCTGGGAAAGG + Intronic
960945417 3:122962997-122963019 AAGTCTCTGCTCTCTGTGAGTGG - Intronic
961118405 3:124351364-124351386 AAGGATCATGATTCTGTGAAGGG + Intronic
961154906 3:124671412-124671434 AAGGCTCTGTAATATGTGTGTGG - Intronic
961572570 3:127810540-127810562 AAGGCTGTGGATTCTGTGTTGGG - Intronic
963780895 3:149485383-149485405 AATGTTCTGGATGCTGAGAGTGG + Intronic
964464607 3:156977196-156977218 TAGGCTCTGTATTCTGTGCCAGG - Intronic
969995899 4:11312873-11312895 CAGGCTCTGGATTAAGAGAGTGG - Intergenic
970009564 4:11444214-11444236 AAGGCTTTGGTTTCTGGGAAAGG + Intergenic
970542087 4:17090205-17090227 ACAGCACTGGATTGTGTGAGTGG - Intergenic
971466575 4:26969761-26969783 CTGTGTCTGGATTCTGTGAGTGG + Intronic
971867021 4:32185590-32185612 CAGCCTATGGATTCTTTGAGTGG + Intergenic
972336718 4:38113416-38113438 TGGGCTCTGGTTTCTGTGTGAGG + Intronic
972921985 4:43954966-43954988 AAATCTCTGGTTTCTGTGAAAGG + Intergenic
975557248 4:75676762-75676784 AAAGATCTGGCTGCTGTGAGGGG - Intronic
977537871 4:98277215-98277237 TAGTGTCTGGATTCTGTTAGTGG - Intronic
982256056 4:153452640-153452662 CAGGTTCTGTATGCTGTGAGGGG + Intergenic
984661269 4:182378394-182378416 ATGGAGCTGGCTTCTGTGAGAGG + Intronic
984833822 4:184000516-184000538 CAAGCTCTGCATTCTATGAGGGG - Intronic
985169783 4:187136557-187136579 ATGGGTCTGGAATCTGGGAGTGG - Intergenic
986213518 5:5696520-5696542 AAGGCTCTGAAATGTGTTAGAGG - Intergenic
986613077 5:9589444-9589466 ATGGCTTTGGAGTCTGTGTGAGG + Intergenic
986782886 5:11083759-11083781 GAGGCTGTGGATTCTGTGGTAGG + Intronic
987010309 5:13756131-13756153 AAGGCACTGGATTCTGCATGGGG + Intronic
988558968 5:32263112-32263134 AAGGCTATAAAGTCTGTGAGAGG - Exonic
993162924 5:84313047-84313069 AATGGTCTGGATTTTGTGACAGG + Intronic
994838304 5:104886329-104886351 ATGGCTCTGGCTTCTGGGAAGGG - Intergenic
996371339 5:122756132-122756154 AGGGCTCTGACTGCTGTGAGTGG + Intergenic
996507348 5:124282723-124282745 ATGGCCCAGGATTCTGTAAGTGG + Intergenic
996979228 5:129469913-129469935 AAGTTTCTGGATTATGAGAGGGG + Intronic
997610472 5:135212438-135212460 AAGGCTGTGACTTCTGTCAGCGG - Intronic
997639906 5:135442358-135442380 AAGTTTCTGGATTCTGTAAGTGG + Intergenic
998496010 5:142590054-142590076 AAAGCTCTGAGTTCTCTGAGTGG + Intergenic
998955124 5:147430797-147430819 AGGGCTTTGGTTTCTCTGAGAGG - Intronic
998999256 5:147901864-147901886 AAGGCTATGAAATTTGTGAGTGG - Intronic
1001724395 5:173884920-173884942 AAGGCTCTAGGTTCTGGGTGTGG + Intergenic
1003033488 6:2623029-2623051 AAAGCTCTGGAAACTGTGATGGG - Exonic
1006059797 6:31411577-31411599 CAGGCTCAGGATTCTGTCGGAGG - Intronic
1006072288 6:31506648-31506670 CAGGCTCAGGCTTCTGTCAGAGG - Intronic
1006105492 6:31713822-31713844 CAGGCTCAGGAATCTGGGAGAGG + Exonic
1006629729 6:35422441-35422463 AAGGCTCTGTCTCCTGGGAGTGG - Intronic
1006897904 6:37482482-37482504 AAGGCTGGGGAGGCTGTGAGTGG - Intronic
1007077163 6:39075225-39075247 AAGGGACTGGGTTCTGGGAGTGG - Intronic
1007567625 6:42864538-42864560 AAGCAGATGGATTCTGTGAGTGG + Intronic
1012054788 6:94392737-94392759 AAGATTCTGGATTCAGAGAGAGG - Intergenic
1013313274 6:108917566-108917588 AAGGAACTGGATTTGGTGAGAGG + Intronic
1016041729 6:139438542-139438564 GAGGCTGTGGCTTCTGTGACTGG - Intergenic
1018811549 6:167301770-167301792 AAGGCGCTGCCTTCAGTGAGTGG + Intronic
1018907887 6:168085778-168085800 AAGGCTTTGGATGCTGTGGCTGG - Intergenic
1019094705 6:169569905-169569927 ATGGCTCTGGGTTTTGTGAGAGG - Intronic
1019450231 7:1093893-1093915 AGGGCTGTGTTTTCTGTGAGGGG - Intronic
1021469215 7:20982035-20982057 AACTGTCTGGCTTCTGTGAGTGG + Intergenic
1021844622 7:24752480-24752502 AACGCTCTGGACTATGTCAGTGG + Intronic
1023187462 7:37547254-37547276 CAGGCTCAGGATCCTCTGAGAGG - Intergenic
1023230600 7:38023834-38023856 CAGGGTCTGGGTTCTGAGAGGGG - Intronic
1023664872 7:42512796-42512818 CAGGCTCTTGATTCTGTGCCAGG + Intergenic
1029871601 7:103699052-103699074 AAGGATCTGGATTCTAGTAGAGG - Intronic
1031080426 7:117252163-117252185 AAGGCCCTGGCTCCTGGGAGGGG + Intergenic
1031786791 7:126043250-126043272 AGTGCTCTGGAGTCTGTGTGTGG - Intergenic
1032257995 7:130312062-130312084 AAAGCTCTGGCTTCTGTGTCGGG + Exonic
1032551045 7:132784738-132784760 AATGCTCTGGAGCCTTTGAGAGG + Intergenic
1032670707 7:134079936-134079958 AAGGCTCTGTATCCTTGGAGAGG - Intergenic
1033319477 7:140326760-140326782 CAGGCTCTGCAATCCGTGAGAGG - Intronic
1035743831 8:1947460-1947482 AAGGCTCTGGCAAGTGTGAGTGG + Intronic
1039691330 8:39867889-39867911 ATGGCTCTGGCATCTGTGTGTGG + Intergenic
1040729390 8:50424232-50424254 TAGGTTCTGTATTCTGGGAGAGG - Intronic
1042281956 8:67064674-67064696 CAGGCTCTGGAATCTGGGGGTGG + Intronic
1043271053 8:78334191-78334213 AAGGCTCTGGTTTCTGTTGAGGG + Intergenic
1044531915 8:93316822-93316844 CAGCCTCAGGATTCTGTGAAGGG + Intergenic
1046912858 8:119647706-119647728 AAGGGTTTGGATTCTGTGGCCGG + Intronic
1050769927 9:9185203-9185225 AAGGTCTTGGATTCTGTGATTGG - Intronic
1051613197 9:18981501-18981523 AGGGCTCTGGGCTCTGTGTGAGG - Intronic
1051810609 9:21045323-21045345 AAGCCTCTGGAGTCTCTGTGTGG + Intergenic
1052028144 9:23597495-23597517 CAGCTTCTGGATTCTGTCAGTGG + Intergenic
1057220155 9:93253144-93253166 AGGGCTCTAAATTCTGTGATGGG + Intronic
1057915362 9:99051286-99051308 AAGGCCATGGTTACTGTGAGAGG - Intronic
1058122991 9:101159205-101159227 AAGGATATGAATTCTGTGACTGG - Intronic
1061326686 9:129868650-129868672 AAGGCTCAGGGCTCTGGGAGAGG - Intronic
1062140774 9:134957657-134957679 AAGGCTCTTGCTTCTGTGCCTGG + Intergenic
1186412316 X:9354729-9354751 AAGGATCTGCAGTCAGTGAGAGG + Intergenic
1186503158 X:10068222-10068244 AATGCTTTGGGTTCTGAGAGTGG - Intronic
1188831248 X:34900027-34900049 AAGGAACTGGATTCTATAAGAGG + Intergenic
1188896434 X:35674472-35674494 AAGGCTCTGCAGTGTGTAAGGGG + Intergenic
1188907025 X:35801674-35801696 CAGGACCTAGATTCTGTGAGAGG - Intronic
1189101096 X:38190790-38190812 AAGGCTCTTCTTTCTTTGAGAGG - Intronic
1189447430 X:41093850-41093872 AAGTTTCTGTACTCTGTGAGTGG + Intronic
1190420828 X:50282557-50282579 AAGGCTCAGGGTTCTGTAGGTGG + Intronic
1192196148 X:69029725-69029747 AAGGCGCAGGAATCAGTGAGCGG - Intergenic
1195274901 X:103272660-103272682 AAGGCTATGTATTCAGTCAGGGG + Intergenic
1198495813 X:137191960-137191982 AAGGCTCTGGTTTCTTTTATTGG - Intergenic
1198921405 X:141732381-141732403 AAGGCTCTGGATTGAGTAACAGG + Intergenic
1199225719 X:145370885-145370907 GACCCTGTGGATTCTGTGAGGGG + Intergenic
1200702032 Y:6410521-6410543 AAGGCTTTGGGTTCTCTGACAGG - Intergenic
1201032079 Y:9754177-9754199 AAGGCTTTGGGTTCTCTGACAGG + Intergenic