ID: 1135564271

View in Genome Browser
Species Human (GRCh38)
Location 16:23499807-23499829
Sequence AGGTTTCTACACTGTGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135564271_1135564283 21 Left 1135564271 16:23499807-23499829 CCTTCCTCACAGTGTAGAAACCT No data
Right 1135564283 16:23499851-23499873 ATGAATGAAAGGTAGGGGTGGGG No data
1135564271_1135564277 14 Left 1135564271 16:23499807-23499829 CCTTCCTCACAGTGTAGAAACCT No data
Right 1135564277 16:23499844-23499866 GCCAGCAATGAATGAAAGGTAGG No data
1135564271_1135564284 28 Left 1135564271 16:23499807-23499829 CCTTCCTCACAGTGTAGAAACCT No data
Right 1135564284 16:23499858-23499880 AAAGGTAGGGGTGGGGCCGCTGG No data
1135564271_1135564279 15 Left 1135564271 16:23499807-23499829 CCTTCCTCACAGTGTAGAAACCT No data
Right 1135564279 16:23499845-23499867 CCAGCAATGAATGAAAGGTAGGG No data
1135564271_1135564282 20 Left 1135564271 16:23499807-23499829 CCTTCCTCACAGTGTAGAAACCT No data
Right 1135564282 16:23499850-23499872 AATGAATGAAAGGTAGGGGTGGG No data
1135564271_1135564276 10 Left 1135564271 16:23499807-23499829 CCTTCCTCACAGTGTAGAAACCT No data
Right 1135564276 16:23499840-23499862 AGCAGCCAGCAATGAATGAAAGG No data
1135564271_1135564280 16 Left 1135564271 16:23499807-23499829 CCTTCCTCACAGTGTAGAAACCT No data
Right 1135564280 16:23499846-23499868 CAGCAATGAATGAAAGGTAGGGG 0: 1
1: 0
2: 3
3: 24
4: 237
1135564271_1135564281 19 Left 1135564271 16:23499807-23499829 CCTTCCTCACAGTGTAGAAACCT No data
Right 1135564281 16:23499849-23499871 CAATGAATGAAAGGTAGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135564271 Original CRISPR AGGTTTCTACACTGTGAGGA AGG (reversed) Intronic
No off target data available for this crispr