ID: 1135565235 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 16:23506756-23506778 |
| Sequence | TTGGGTGCTCAAGTGGAACA GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1135565235_1135565243 | -3 | Left | 1135565235 | 16:23506756-23506778 | CCCTGTTCCACTTGAGCACCCAA | No data | ||
| Right | 1135565243 | 16:23506776-23506798 | CAATACTCAGGTGGCAATGGTGG | No data | ||||
| 1135565235_1135565240 | -6 | Left | 1135565235 | 16:23506756-23506778 | CCCTGTTCCACTTGAGCACCCAA | No data | ||
| Right | 1135565240 | 16:23506773-23506795 | ACCCAATACTCAGGTGGCAATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1135565235 | Original CRISPR | TTGGGTGCTCAAGTGGAACA GGG (reversed) | Intronic | ||
| No off target data available for this crispr | |||||