ID: 1135565235

View in Genome Browser
Species Human (GRCh38)
Location 16:23506756-23506778
Sequence TTGGGTGCTCAAGTGGAACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135565235_1135565243 -3 Left 1135565235 16:23506756-23506778 CCCTGTTCCACTTGAGCACCCAA No data
Right 1135565243 16:23506776-23506798 CAATACTCAGGTGGCAATGGTGG No data
1135565235_1135565240 -6 Left 1135565235 16:23506756-23506778 CCCTGTTCCACTTGAGCACCCAA No data
Right 1135565240 16:23506773-23506795 ACCCAATACTCAGGTGGCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135565235 Original CRISPR TTGGGTGCTCAAGTGGAACA GGG (reversed) Intronic
No off target data available for this crispr