ID: 1135566157

View in Genome Browser
Species Human (GRCh38)
Location 16:23512640-23512662
Sequence GTTCAAACCAGTCCAAAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135566157_1135566158 1 Left 1135566157 16:23512640-23512662 CCATTCTTTGGACTGGTTTGAAC No data
Right 1135566158 16:23512664-23512686 TCTCACCAGTTTCCTCATTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135566157 Original CRISPR GTTCAAACCAGTCCAAAGAA TGG (reversed) Intronic
No off target data available for this crispr