ID: 1135566644

View in Genome Browser
Species Human (GRCh38)
Location 16:23516310-23516332
Sequence CCAAATTATAGAAGCTGAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135566644_1135566647 28 Left 1135566644 16:23516310-23516332 CCTTTTCAGCTTCTATAATTTGG No data
Right 1135566647 16:23516361-23516383 TTCCTAGATATATATCCTGTTGG No data
1135566644_1135566648 29 Left 1135566644 16:23516310-23516332 CCTTTTCAGCTTCTATAATTTGG No data
Right 1135566648 16:23516362-23516384 TCCTAGATATATATCCTGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135566644 Original CRISPR CCAAATTATAGAAGCTGAAA AGG (reversed) Intronic
No off target data available for this crispr