ID: 1135566648

View in Genome Browser
Species Human (GRCh38)
Location 16:23516362-23516384
Sequence TCCTAGATATATATCCTGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135566644_1135566648 29 Left 1135566644 16:23516310-23516332 CCTTTTCAGCTTCTATAATTTGG No data
Right 1135566648 16:23516362-23516384 TCCTAGATATATATCCTGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135566648 Original CRISPR TCCTAGATATATATCCTGTT GGG Intronic
No off target data available for this crispr