ID: 1135571980

View in Genome Browser
Species Human (GRCh38)
Location 16:23556731-23556753
Sequence TCCAGAAGGCTTTACTGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 222}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135571980_1135571987 26 Left 1135571980 16:23556731-23556753 CCTGCTCAGTAAAGCCTTCTGGA 0: 1
1: 0
2: 1
3: 16
4: 222
Right 1135571987 16:23556780-23556802 ATCCTGTTTCACTTCCCGCATGG 0: 1
1: 0
2: 1
3: 9
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135571980 Original CRISPR TCCAGAAGGCTTTACTGAGC AGG (reversed) Intronic